Incidental Mutation 'R9205:Man2a2'
ID 698445
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 80349097-80371375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80361120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 708 (V708I)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206301] [ENSMUST00000206807]
AlphaFold Q8BRK9
Predicted Effect probably benign
Transcript: ENSMUST00000098346
AA Change: V708I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: V708I

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205853
Predicted Effect probably benign
Transcript: ENSMUST00000206301
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,642,228 H341Q probably damaging Het
Apob G A 12: 7,980,635 A125T probably damaging Het
Bace2 G T 16: 97,356,859 A20S unknown Het
Bcar1 T C 8: 111,715,709 Y238C probably damaging Het
Brinp3 A T 1: 146,902,089 D758V possibly damaging Het
Btnl10 T C 11: 58,920,519 S223P probably damaging Het
Cckar C T 5: 53,707,245 probably null Het
Cdhr2 A G 13: 54,713,988 N66S probably benign Het
Chd9 A G 8: 91,030,642 M1890V probably benign Het
Col6a5 C T 9: 105,878,638 G2196R probably damaging Het
Col9a1 T G 1: 24,185,094 M119R unknown Het
Cryaa A G 17: 31,679,668 H123R probably damaging Het
Cux1 A T 5: 136,370,135 D171E probably damaging Het
Dgkz T A 2: 91,933,799 T1067S probably benign Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah5 T C 15: 28,448,334 M4181T possibly damaging Het
Dnajb14 A G 3: 137,908,384 E352G possibly damaging Het
Dnmt3l T A 10: 78,056,752 probably null Het
Dph6 T C 2: 114,569,514 I117V probably damaging Het
Dsg1a A G 18: 20,340,171 D767G probably damaging Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Elmsan1 A C 12: 84,152,887 F1020V probably benign Het
Fbln7 A C 2: 128,895,248 S328R probably null Het
Fbn2 T C 18: 58,059,356 R1518G probably damaging Het
Foxi2 A T 7: 135,411,796 T252S probably benign Het
Foxred2 A G 15: 77,952,006 S384P probably damaging Het
Gdpd1 G A 11: 87,045,183 H174Y probably benign Het
Gm10542 A C 18: 44,204,638 D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,635,850 probably benign Het
H2-Ab1 A G 17: 34,265,007 E114G probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Igfn1 C T 1: 135,975,957 V348I probably damaging Het
Itpr1 T A 6: 108,489,849 L2173Q probably damaging Het
Lamp5 A G 2: 136,059,601 Y115C probably damaging Het
Lrp1 T A 10: 127,594,981 K400* probably null Het
Matr3 T C 18: 35,587,721 S746P probably benign Het
Me1 C T 9: 86,598,794 V353M probably benign Het
Nbeal1 T A 1: 60,278,680 D1925E probably damaging Het
Oca2 T A 7: 56,316,420 F387I probably damaging Het
Olfr1163 T A 2: 88,070,434 H316L probably benign Het
Olfr181 T G 16: 58,926,122 I150L probably benign Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr212 T A 6: 116,516,354 N192K probably benign Het
Olfr420 T C 1: 174,158,890 I39T probably benign Het
Olfr912 T A 9: 38,582,077 S267T probably benign Het
Opn3 G T 1: 175,663,089 N335K probably benign Het
Osm A G 11: 4,238,504 N44D possibly damaging Het
Otop2 T C 11: 115,329,086 Y251H probably damaging Het
Pappa T C 4: 65,156,375 S389P possibly damaging Het
Polr1d C T 5: 147,101,258 A19V probably damaging Het
Ptchd4 G A 17: 42,503,385 V726M probably benign Het
Pzp T A 6: 128,496,663 D731V probably benign Het
Rgl2 A T 17: 33,936,028 I669F probably damaging Het
Rpl38 T C 11: 114,672,288 *71R probably null Het
Rufy1 G A 11: 50,398,474 R514W probably damaging Het
Ruvbl2 G A 7: 45,434,317 probably benign Het
Scn9a T G 2: 66,533,313 I874L probably damaging Het
Slc14a2 A G 18: 78,195,736 S85P probably benign Het
Slc17a1 A G 13: 23,878,811 I287V probably benign Het
Slc35f3 T A 8: 126,389,189 I285N probably damaging Het
Slx4 A G 16: 3,988,063 S542P possibly damaging Het
Sox30 A T 11: 46,017,353 L782F probably damaging Het
Sspo A G 6: 48,455,872 N894S probably benign Het
Syne1 G A 10: 5,202,013 Q5765* probably null Het
Taar7e T C 10: 24,038,074 I154T probably benign Het
Tars A G 15: 11,397,179 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem198b A T 10: 128,803,188 C29S probably damaging Het
Tnr A C 1: 159,895,047 M1021L probably benign Het
Tom1l1 G A 11: 90,657,818 P309L probably damaging Het
Traf4 A G 11: 78,161,101 S186P probably benign Het
Trpm1 T G 7: 64,240,571 V974G possibly damaging Het
Tsga10 T A 1: 37,841,278 probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r93 A T 17: 18,304,019 I92F probably damaging Het
Zfp457 A T 13: 67,293,901 D203E probably benign Het
Zfp518b G A 5: 38,674,158 S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp777 G A 6: 48,025,587 T523M probably benign Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80353319 missense probably damaging 1.00
R9563:Man2a2 UTSW 7 80356353 missense probably benign
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAACCAGACCTGCATGTAGC -3'
(R):5'- ACTGTGTGCCTTTGCTGACG -3'

Sequencing Primer
(F):5'- CGATTGCTGATGGCGAAGTC -3'
(R):5'- CTTTGCTGACGAGTGTGCAGAAG -3'
Posted On 2022-02-07