Incidental Mutation 'R9205:Thap1'
ID 698447
Institutional Source Beutler Lab
Gene Symbol Thap1
Ensembl Gene ENSMUSG00000037214
Gene Name THAP domain containing, apoptosis associated protein 1
Synonyms 4833431A01Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9205 (G1)
Quality Score 165.468
Status Validated
Chromosome 8
Chromosomal Location 26648197-26654179 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CAGCATCTGCTCGGAGCA to CAGCA at 26650884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036807] [ENSMUST00000130231] [ENSMUST00000131138]
AlphaFold Q8CHW1
Predicted Effect probably null
Transcript: ENSMUST00000036807
SMART Domains Protein: ENSMUSP00000042464
Gene: ENSMUSG00000037214

DomainStartEndE-ValueType
THAP 3 86 6.6e-20 SMART
DM3 22 86 3.01e-16 SMART
low complexity region 93 108 N/A INTRINSIC
coiled coil region 137 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127536
Predicted Effect probably null
Transcript: ENSMUST00000130231
SMART Domains Protein: ENSMUSP00000121153
Gene: ENSMUSG00000037214

DomainStartEndE-ValueType
DM3 2 63 1.13e-11 SMART
THAP 2 63 6.77e-8 SMART
low complexity region 70 85 N/A INTRINSIC
SCOP:d1lxa__ 121 173 8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131138
SMART Domains Protein: ENSMUSP00000115452
Gene: ENSMUSG00000109850

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209926
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO is embryonic lethal. Heterozygous KO affects motor control and the morphology of the cerebellum dentate nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Thap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Thap1 APN 8 26,652,759 (GRCm39) missense probably benign 0.21
IGL00990:Thap1 APN 8 26,650,910 (GRCm39) missense possibly damaging 0.74
IGL02491:Thap1 APN 8 26,650,885 (GRCm39) missense probably damaging 0.97
IGL03097:Thap1 UTSW 8 26,652,498 (GRCm39) missense probably benign
IGL03098:Thap1 UTSW 8 26,652,498 (GRCm39) missense probably benign
R0755:Thap1 UTSW 8 26,648,501 (GRCm39) missense probably damaging 1.00
R0927:Thap1 UTSW 8 26,652,733 (GRCm39) missense probably benign 0.00
R4645:Thap1 UTSW 8 26,652,597 (GRCm39) missense probably damaging 1.00
R4661:Thap1 UTSW 8 26,650,874 (GRCm39) missense probably benign 0.04
R4803:Thap1 UTSW 8 26,650,882 (GRCm39) frame shift probably null
R4978:Thap1 UTSW 8 26,650,882 (GRCm39) frame shift probably null
R6424:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R6447:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R6503:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R6995:Thap1 UTSW 8 26,652,679 (GRCm39) missense probably damaging 1.00
R7169:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R7923:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R8209:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R8419:Thap1 UTSW 8 26,648,502 (GRCm39) nonsense probably null
R8519:Thap1 UTSW 8 26,650,925 (GRCm39) missense probably damaging 0.97
R8732:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R8832:Thap1 UTSW 8 26,648,261 (GRCm39) intron probably benign
R8863:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9271:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9319:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9332:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9332:Thap1 UTSW 8 26,650,882 (GRCm39) frame shift probably null
R9380:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9414:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9430:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9441:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9460:Thap1 UTSW 8 26,650,884 (GRCm39) frame shift probably null
R9739:Thap1 UTSW 8 26,650,990 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCAGAGTCTCCTTAGGATGGGG -3'
(R):5'- CCCATGAACACATTAGCTTCAG -3'

Sequencing Primer
(F):5'- GTAAGGTAGTTCTTTAGTAAGCCGG -3'
(R):5'- ATCAGGAGTTCCGATTCAGC -3'
Posted On 2022-02-07