Incidental Mutation 'R9205:Bcar1'
ID 698449
Institutional Source Beutler Lab
Gene Symbol Bcar1
Ensembl Gene ENSMUSG00000031955
Gene Name breast cancer anti-estrogen resistance 1
Synonyms p130Cas, Cas, Crkas
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 111710474-111743809 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111715709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 238 (Y238C)
Ref Sequence ENSEMBL: ENSMUSP00000129584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166232] [ENSMUST00000212349]
AlphaFold Q61140
Predicted Effect probably damaging
Transcript: ENSMUST00000166232
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129584
Gene: ENSMUSG00000031955
AA Change: Y238C

DomainStartEndE-ValueType
SH3 6 64 3e-20 SMART
low complexity region 71 92 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 353 388 N/A INTRINSIC
low complexity region 430 448 N/A INTRINSIC
Pfam:Serine_rich 458 612 9e-49 PFAM
Pfam:DUF3513 658 868 2.1e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212349
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCAR1, or CAS, is an Src (MIM 190090) family kinase substrate involved in various cellular events, including migration, survival, transformation, and invasion (Sawada et al., 2006 [PubMed 17129785]).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous null embryos exhibit growth retardation and embryonic lethality, following disruption of cardiac myofibrils, increased vasodilation, and systemic congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,642,228 H341Q probably damaging Het
Apob G A 12: 7,980,635 A125T probably damaging Het
Bace2 G T 16: 97,356,859 A20S unknown Het
Brinp3 A T 1: 146,902,089 D758V possibly damaging Het
Btnl10 T C 11: 58,920,519 S223P probably damaging Het
Cckar C T 5: 53,707,245 probably null Het
Cdhr2 A G 13: 54,713,988 N66S probably benign Het
Chd9 A G 8: 91,030,642 M1890V probably benign Het
Col6a5 C T 9: 105,878,638 G2196R probably damaging Het
Col9a1 T G 1: 24,185,094 M119R unknown Het
Cryaa A G 17: 31,679,668 H123R probably damaging Het
Cux1 A T 5: 136,370,135 D171E probably damaging Het
Dgkz T A 2: 91,933,799 T1067S probably benign Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah5 T C 15: 28,448,334 M4181T possibly damaging Het
Dnajb14 A G 3: 137,908,384 E352G possibly damaging Het
Dnmt3l T A 10: 78,056,752 probably null Het
Dph6 T C 2: 114,569,514 I117V probably damaging Het
Dsg1a A G 18: 20,340,171 D767G probably damaging Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Elmsan1 A C 12: 84,152,887 F1020V probably benign Het
Fbln7 A C 2: 128,895,248 S328R probably null Het
Fbn2 T C 18: 58,059,356 R1518G probably damaging Het
Foxi2 A T 7: 135,411,796 T252S probably benign Het
Foxred2 A G 15: 77,952,006 S384P probably damaging Het
Gdpd1 G A 11: 87,045,183 H174Y probably benign Het
Gm10542 A C 18: 44,204,638 D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,635,850 probably benign Het
H2-Ab1 A G 17: 34,265,007 E114G probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Igfn1 C T 1: 135,975,957 V348I probably damaging Het
Itpr1 T A 6: 108,489,849 L2173Q probably damaging Het
Lamp5 A G 2: 136,059,601 Y115C probably damaging Het
Lrp1 T A 10: 127,594,981 K400* probably null Het
Man2a2 C T 7: 80,361,120 V708I probably benign Het
Matr3 T C 18: 35,587,721 S746P probably benign Het
Me1 C T 9: 86,598,794 V353M probably benign Het
Nbeal1 T A 1: 60,278,680 D1925E probably damaging Het
Oca2 T A 7: 56,316,420 F387I probably damaging Het
Olfr1163 T A 2: 88,070,434 H316L probably benign Het
Olfr181 T G 16: 58,926,122 I150L probably benign Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr212 T A 6: 116,516,354 N192K probably benign Het
Olfr420 T C 1: 174,158,890 I39T probably benign Het
Olfr912 T A 9: 38,582,077 S267T probably benign Het
Opn3 G T 1: 175,663,089 N335K probably benign Het
Osm A G 11: 4,238,504 N44D possibly damaging Het
Otop2 T C 11: 115,329,086 Y251H probably damaging Het
Pappa T C 4: 65,156,375 S389P possibly damaging Het
Polr1d C T 5: 147,101,258 A19V probably damaging Het
Ptchd4 G A 17: 42,503,385 V726M probably benign Het
Pzp T A 6: 128,496,663 D731V probably benign Het
Rgl2 A T 17: 33,936,028 I669F probably damaging Het
Rpl38 T C 11: 114,672,288 *71R probably null Het
Rufy1 G A 11: 50,398,474 R514W probably damaging Het
Ruvbl2 G A 7: 45,434,317 probably benign Het
Scn9a T G 2: 66,533,313 I874L probably damaging Het
Slc14a2 A G 18: 78,195,736 S85P probably benign Het
Slc17a1 A G 13: 23,878,811 I287V probably benign Het
Slc35f3 T A 8: 126,389,189 I285N probably damaging Het
Slx4 A G 16: 3,988,063 S542P possibly damaging Het
Sox30 A T 11: 46,017,353 L782F probably damaging Het
Sspo A G 6: 48,455,872 N894S probably benign Het
Syne1 G A 10: 5,202,013 Q5765* probably null Het
Taar7e T C 10: 24,038,074 I154T probably benign Het
Tars A G 15: 11,397,179 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem198b A T 10: 128,803,188 C29S probably damaging Het
Tnr A C 1: 159,895,047 M1021L probably benign Het
Tom1l1 G A 11: 90,657,818 P309L probably damaging Het
Traf4 A G 11: 78,161,101 S186P probably benign Het
Trpm1 T G 7: 64,240,571 V974G possibly damaging Het
Tsga10 T A 1: 37,841,278 probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r93 A T 17: 18,304,019 I92F probably damaging Het
Zfp457 A T 13: 67,293,901 D203E probably benign Het
Zfp518b G A 5: 38,674,158 S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp777 G A 6: 48,025,587 T523M probably benign Het
Other mutations in Bcar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcar1 APN 8 111711207 missense possibly damaging 0.82
IGL02852:Bcar1 APN 8 111715347 nonsense probably null
R1914:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R1915:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R4130:Bcar1 UTSW 8 111714165 missense possibly damaging 0.47
R4249:Bcar1 UTSW 8 111720893 missense probably benign
R4437:Bcar1 UTSW 8 111715389 missense probably damaging 1.00
R4794:Bcar1 UTSW 8 111720920 nonsense probably null
R4937:Bcar1 UTSW 8 111721037 missense probably damaging 0.98
R5402:Bcar1 UTSW 8 111714330 missense probably damaging 1.00
R5951:Bcar1 UTSW 8 111713400 missense probably benign 0.02
R6443:Bcar1 UTSW 8 111715338 missense probably damaging 1.00
R7595:Bcar1 UTSW 8 111720993 missense probably benign 0.01
R8313:Bcar1 UTSW 8 111713638 missense probably benign 0.01
R8373:Bcar1 UTSW 8 111715738 nonsense probably null
R9037:Bcar1 UTSW 8 111720890 missense probably benign 0.10
R9602:Bcar1 UTSW 8 111713866 missense probably benign 0.22
RF025:Bcar1 UTSW 8 111714177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCTTGGCTAGGCTGAGAAAATG -3'
(R):5'- ACTGCAGAAAAGGAGCTCCC -3'

Sequencing Primer
(F):5'- CTAGGCTGAGAAAATGCAGCTCC -3'
(R):5'- TGAGAAGCAGGGCCTCGAC -3'
Posted On 2022-02-07