Incidental Mutation 'R9205:Dnmt3l'
ID 698456
Institutional Source Beutler Lab
Gene Symbol Dnmt3l
Ensembl Gene ENSMUSG00000000730
Gene Name DNA (cytosine-5-)-methyltransferase 3-like
Synonyms D6Ertd14e, ecat7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9205 (G1)
Quality Score 183.009
Status Not validated
Chromosome 10
Chromosomal Location 78041947-78063622 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 78056752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]
AlphaFold Q9CWR8
Predicted Effect probably benign
Transcript: ENSMUST00000000746
SMART Domains Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000123940
SMART Domains Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131825
SMART Domains Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138785
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139539
SMART Domains Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151242
SMART Domains Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,642,228 H341Q probably damaging Het
Apob G A 12: 7,980,635 A125T probably damaging Het
Bace2 G T 16: 97,356,859 A20S unknown Het
Bcar1 T C 8: 111,715,709 Y238C probably damaging Het
Brinp3 A T 1: 146,902,089 D758V possibly damaging Het
Btnl10 T C 11: 58,920,519 S223P probably damaging Het
Cckar C T 5: 53,707,245 probably null Het
Cdhr2 A G 13: 54,713,988 N66S probably benign Het
Chd9 A G 8: 91,030,642 M1890V probably benign Het
Col6a5 C T 9: 105,878,638 G2196R probably damaging Het
Col9a1 T G 1: 24,185,094 M119R unknown Het
Cryaa A G 17: 31,679,668 H123R probably damaging Het
Cux1 A T 5: 136,370,135 D171E probably damaging Het
Dgkz T A 2: 91,933,799 T1067S probably benign Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah5 T C 15: 28,448,334 M4181T possibly damaging Het
Dnajb14 A G 3: 137,908,384 E352G possibly damaging Het
Dph6 T C 2: 114,569,514 I117V probably damaging Het
Dsg1a A G 18: 20,340,171 D767G probably damaging Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Elmsan1 A C 12: 84,152,887 F1020V probably benign Het
Fbln7 A C 2: 128,895,248 S328R probably null Het
Fbn2 T C 18: 58,059,356 R1518G probably damaging Het
Foxi2 A T 7: 135,411,796 T252S probably benign Het
Foxred2 A G 15: 77,952,006 S384P probably damaging Het
Gdpd1 G A 11: 87,045,183 H174Y probably benign Het
Gm10542 A C 18: 44,204,638 D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,635,850 probably benign Het
H2-Ab1 A G 17: 34,265,007 E114G probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Igfn1 C T 1: 135,975,957 V348I probably damaging Het
Itpr1 T A 6: 108,489,849 L2173Q probably damaging Het
Lamp5 A G 2: 136,059,601 Y115C probably damaging Het
Lrp1 T A 10: 127,594,981 K400* probably null Het
Man2a2 C T 7: 80,361,120 V708I probably benign Het
Matr3 T C 18: 35,587,721 S746P probably benign Het
Me1 C T 9: 86,598,794 V353M probably benign Het
Nbeal1 T A 1: 60,278,680 D1925E probably damaging Het
Oca2 T A 7: 56,316,420 F387I probably damaging Het
Olfr1163 T A 2: 88,070,434 H316L probably benign Het
Olfr181 T G 16: 58,926,122 I150L probably benign Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr212 T A 6: 116,516,354 N192K probably benign Het
Olfr420 T C 1: 174,158,890 I39T probably benign Het
Olfr912 T A 9: 38,582,077 S267T probably benign Het
Opn3 G T 1: 175,663,089 N335K probably benign Het
Osm A G 11: 4,238,504 N44D possibly damaging Het
Otop2 T C 11: 115,329,086 Y251H probably damaging Het
Pappa T C 4: 65,156,375 S389P possibly damaging Het
Polr1d C T 5: 147,101,258 A19V probably damaging Het
Ptchd4 G A 17: 42,503,385 V726M probably benign Het
Pzp T A 6: 128,496,663 D731V probably benign Het
Rgl2 A T 17: 33,936,028 I669F probably damaging Het
Rpl38 T C 11: 114,672,288 *71R probably null Het
Rufy1 G A 11: 50,398,474 R514W probably damaging Het
Ruvbl2 G A 7: 45,434,317 probably benign Het
Scn9a T G 2: 66,533,313 I874L probably damaging Het
Slc14a2 A G 18: 78,195,736 S85P probably benign Het
Slc17a1 A G 13: 23,878,811 I287V probably benign Het
Slc35f3 T A 8: 126,389,189 I285N probably damaging Het
Slx4 A G 16: 3,988,063 S542P possibly damaging Het
Sox30 A T 11: 46,017,353 L782F probably damaging Het
Sspo A G 6: 48,455,872 N894S probably benign Het
Syne1 G A 10: 5,202,013 Q5765* probably null Het
Taar7e T C 10: 24,038,074 I154T probably benign Het
Tars A G 15: 11,397,179 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem198b A T 10: 128,803,188 C29S probably damaging Het
Tnr A C 1: 159,895,047 M1021L probably benign Het
Tom1l1 G A 11: 90,657,818 P309L probably damaging Het
Traf4 A G 11: 78,161,101 S186P probably benign Het
Trpm1 T G 7: 64,240,571 V974G possibly damaging Het
Tsga10 T A 1: 37,841,278 probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r93 A T 17: 18,304,019 I92F probably damaging Het
Zfp457 A T 13: 67,293,901 D203E probably benign Het
Zfp518b G A 5: 38,674,158 S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp777 G A 6: 48,025,587 T523M probably benign Het
Other mutations in Dnmt3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnmt3l APN 10 78057355 missense probably damaging 1.00
IGL00827:Dnmt3l APN 10 78053996 missense probably damaging 1.00
IGL01072:Dnmt3l APN 10 78052771 missense probably benign 0.09
IGL01118:Dnmt3l APN 10 78057286 missense probably damaging 0.97
IGL01553:Dnmt3l APN 10 78063248 missense probably benign 0.00
IGL02322:Dnmt3l APN 10 78052738 missense possibly damaging 0.90
IGL02323:Dnmt3l APN 10 78063318 missense probably damaging 1.00
IGL02618:Dnmt3l APN 10 78054022 splice site probably benign
IGL02701:Dnmt3l APN 10 78055022 missense probably benign 0.01
IGL02950:Dnmt3l APN 10 78050951 missense probably benign 0.01
R0318:Dnmt3l UTSW 10 78055055 missense probably damaging 1.00
R0384:Dnmt3l UTSW 10 78052737 missense possibly damaging 0.95
R0391:Dnmt3l UTSW 10 78051916 splice site probably benign
R1144:Dnmt3l UTSW 10 78051905 missense probably damaging 1.00
R2069:Dnmt3l UTSW 10 78052732 missense probably damaging 1.00
R2115:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2116:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2117:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R4812:Dnmt3l UTSW 10 78057294 missense probably benign 0.06
R5001:Dnmt3l UTSW 10 78059731 missense probably null 1.00
R5039:Dnmt3l UTSW 10 78052900 splice site probably null
R5389:Dnmt3l UTSW 10 78056831 splice site probably null
R5799:Dnmt3l UTSW 10 78052026 missense possibly damaging 0.71
R5811:Dnmt3l UTSW 10 78052095 missense possibly damaging 0.78
R5875:Dnmt3l UTSW 10 78053938 missense probably benign
R6314:Dnmt3l UTSW 10 78059687 missense probably benign 0.00
R6537:Dnmt3l UTSW 10 78052064 missense probably null 1.00
R8437:Dnmt3l UTSW 10 78052768 missense possibly damaging 0.94
R9108:Dnmt3l UTSW 10 78056922 critical splice donor site probably null
R9171:Dnmt3l UTSW 10 78059684 missense probably benign
R9473:Dnmt3l UTSW 10 78050188 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGAGTTTCCGTGCTCCC -3'
(R):5'- AGTTCACCTGGCAGTTAAGAG -3'

Sequencing Primer
(F):5'- GAGTTTCCGTGCTCCCTCCAG -3'
(R):5'- AAGGTCCTGAGTTCAATTCCCAG -3'
Posted On 2022-02-07