Incidental Mutation 'R9205:Sox30'
ID 698460
Institutional Source Beutler Lab
Gene Symbol Sox30
Ensembl Gene ENSMUSG00000040489
Gene Name SRY (sex determining region Y)-box 30
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 45871137-45908821 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45908180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 782 (L782F)
Ref Sequence ENSEMBL: ENSMUSP00000037519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049038]
AlphaFold Q8CGW4
Predicted Effect probably damaging
Transcript: ENSMUST00000049038
AA Change: L782F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: L782F

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
low complexity region 92 104 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 210 220 N/A INTRINSIC
HMG 365 435 8.35e-24 SMART
low complexity region 523 539 N/A INTRINSIC
Blast:Pept_C1 572 734 1e-92 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Sox30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Sox30 APN 11 45,882,727 (GRCm39) missense possibly damaging 0.95
IGL01449:Sox30 APN 11 45,872,169 (GRCm39) missense probably damaging 1.00
IGL02411:Sox30 APN 11 45,871,951 (GRCm39) nonsense probably null
IGL02601:Sox30 APN 11 45,875,589 (GRCm39) missense possibly damaging 0.81
IGL02747:Sox30 APN 11 45,871,772 (GRCm39) missense probably benign 0.00
IGL03403:Sox30 APN 11 45,908,035 (GRCm39) missense probably damaging 1.00
R0104:Sox30 UTSW 11 45,872,141 (GRCm39) missense possibly damaging 0.93
R1450:Sox30 UTSW 11 45,908,098 (GRCm39) missense probably damaging 0.99
R2109:Sox30 UTSW 11 45,882,595 (GRCm39) missense probably damaging 0.99
R2213:Sox30 UTSW 11 45,875,679 (GRCm39) missense probably damaging 1.00
R3715:Sox30 UTSW 11 45,875,619 (GRCm39) missense probably damaging 0.99
R4111:Sox30 UTSW 11 45,908,041 (GRCm39) missense probably benign 0.09
R4723:Sox30 UTSW 11 45,875,592 (GRCm39) missense probably benign 0.03
R5014:Sox30 UTSW 11 45,882,736 (GRCm39) missense probably benign 0.01
R5408:Sox30 UTSW 11 45,882,694 (GRCm39) missense possibly damaging 0.54
R5974:Sox30 UTSW 11 45,871,900 (GRCm39) missense probably damaging 0.99
R6063:Sox30 UTSW 11 45,882,769 (GRCm39) missense probably benign 0.04
R6948:Sox30 UTSW 11 45,908,166 (GRCm39) missense probably damaging 1.00
R7242:Sox30 UTSW 11 45,875,347 (GRCm39) splice site probably null
R7258:Sox30 UTSW 11 45,871,379 (GRCm39) missense unknown
R8195:Sox30 UTSW 11 45,882,592 (GRCm39) missense probably benign 0.00
R9605:Sox30 UTSW 11 45,875,640 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGACTCTCGGAGCTGTGAG -3'
(R):5'- TTTTAAGATCCCTACGCTGAGGC -3'

Sequencing Primer
(F):5'- GGCCCCCTTACTACAGCAG -3'
(R):5'- TGAGGCATCGGGAGTCCAG -3'
Posted On 2022-02-07