Mutagenetix > Incidental Mutation

Incidental Mutation 'R9205:Apob'

698468

Institutional Source

Beutler Lab

Gene Symbol

Apob

Ensembl Gene

ENSMUSG00000020609

Gene Name

apolipoprotein B

Synonyms

apob-100, apob-48

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R9205 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7977648-8016835 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 7980635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 125 (A125T)

Ref Sequence

ENSEMBL: ENSMUSP00000036044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171271]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000037520
AA Change: A112T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: A112T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	33	585	6.03e-94	SMART
DUF1943	619	932	7.88e-97	SMART
Pfam:DUF1081	945	1059	9.4e-32	PFAM
low complexity region	1100	1109	N/A	INTRINSIC
Blast:LPD_N	1249	1311	9e-22	BLAST
low complexity region	1632	1644	N/A	INTRINSIC
internal_repeat_1	1882	2038	6.61e-9	PROSPERO
SCOP:d1gw5a_	2105	2577	9e-5	SMART
internal_repeat_1	2973	3150	6.61e-9	PROSPERO
low complexity region	3561	3580	N/A	INTRINSIC
low complexity region	3928	3936	N/A	INTRINSIC
Pfam:ApoB100_C	4401	4456	5.6e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000037811
AA Change: A125T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: A125T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	46	598	6.03e-94	SMART
DUF1943	632	945	7.88e-97	SMART
Pfam:DUF1081	960	1070	6.3e-39	PFAM
low complexity region	1113	1122	N/A	INTRINSIC
Blast:LPD_N	1282	1344	1e-21	BLAST
low complexity region	1665	1677	N/A	INTRINSIC
internal_repeat_1	1915	2071	6.6e-9	PROSPERO
SCOP:d1gw5a_	2138	2610	9e-5	SMART
internal_repeat_1	3006	3183	6.6e-9	PROSPERO
low complexity region	3594	3613	N/A	INTRINSIC
low complexity region	3961	3969	N/A	INTRINSIC
Pfam:ApoB100_C	4434	4490	1.6e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171271
AA Change: A124T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000127147
Gene: ENSMUSG00000020609
AA Change: A124T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Vitellogenin_N	45	324	6.7e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.3%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp2	T	A	6: 140,642,228	H341Q	probably damaging	Het
Bace2	G	T	16: 97,356,859	A20S	unknown	Het
Bcar1	T	C	8: 111,715,709	Y238C	probably damaging	Het
Brinp3	A	T	1: 146,902,089	D758V	possibly damaging	Het
Btnl10	T	C	11: 58,920,519	S223P	probably damaging	Het
Cckar	C	T	5: 53,707,245		probably null	Het
Cdhr2	A	G	13: 54,713,988	N66S	probably benign	Het
Chd9	A	G	8: 91,030,642	M1890V	probably benign	Het
Col6a5	C	T	9: 105,878,638	G2196R	probably damaging	Het
Col9a1	T	G	1: 24,185,094	M119R	unknown	Het
Cryaa	A	G	17: 31,679,668	H123R	probably damaging	Het
Cux1	A	T	5: 136,370,135	D171E	probably damaging	Het
Dgkz	T	A	2: 91,933,799	T1067S	probably benign	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dnah5	T	C	15: 28,448,334	M4181T	possibly damaging	Het
Dnajb14	A	G	3: 137,908,384	E352G	possibly damaging	Het
Dnmt3l	T	A	10: 78,056,752		probably null	Het
Dph6	T	C	2: 114,569,514	I117V	probably damaging	Het
Dsg1a	A	G	18: 20,340,171	D767G	probably damaging	Het
Edn3	C	T	2: 174,761,689	P77S	possibly damaging	Het
Elmsan1	A	C	12: 84,152,887	F1020V	probably benign	Het
Fbln7	A	C	2: 128,895,248	S328R	probably null	Het
Fbn2	T	C	18: 58,059,356	R1518G	probably damaging	Het
Foxi2	A	T	7: 135,411,796	T252S	probably benign	Het
Foxred2	A	G	15: 77,952,006	S384P	probably damaging	Het
Gdpd1	G	A	11: 87,045,183	H174Y	probably benign	Het
Gm10542	A	C	18: 44,204,638	D61A	possibly damaging	Het
Gm10563	TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	4: 155,635,850		probably benign	Het
H2-Ab1	A	G	17: 34,265,007	E114G	probably damaging	Het
Htt	C	T	5: 34,819,023	T723M	probably benign	Het
Igfn1	C	T	1: 135,975,957	V348I	probably damaging	Het
Itpr1	T	A	6: 108,489,849	L2173Q	probably damaging	Het
Lamp5	A	G	2: 136,059,601	Y115C	probably damaging	Het
Lrp1	T	A	10: 127,594,981	K400*	probably null	Het
Man2a2	C	T	7: 80,361,120	V708I	probably benign	Het
Matr3	T	C	18: 35,587,721	S746P	probably benign	Het
Me1	C	T	9: 86,598,794	V353M	probably benign	Het
Nbeal1	T	A	1: 60,278,680	D1925E	probably damaging	Het
Oca2	T	A	7: 56,316,420	F387I	probably damaging	Het
Olfr1163	T	A	2: 88,070,434	H316L	probably benign	Het
Olfr181	T	G	16: 58,926,122	I150L	probably benign	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr212	T	A	6: 116,516,354	N192K	probably benign	Het
Olfr420	T	C	1: 174,158,890	I39T	probably benign	Het
Olfr912	T	A	9: 38,582,077	S267T	probably benign	Het
Opn3	G	T	1: 175,663,089	N335K	probably benign	Het
Osm	A	G	11: 4,238,504	N44D	possibly damaging	Het
Otop2	T	C	11: 115,329,086	Y251H	probably damaging	Het
Pappa	T	C	4: 65,156,375	S389P	possibly damaging	Het
Polr1d	C	T	5: 147,101,258	A19V	probably damaging	Het
Ptchd4	G	A	17: 42,503,385	V726M	probably benign	Het
Pzp	T	A	6: 128,496,663	D731V	probably benign	Het
Rgl2	A	T	17: 33,936,028	I669F	probably damaging	Het
Rpl38	T	C	11: 114,672,288	*71R	probably null	Het
Rufy1	G	A	11: 50,398,474	R514W	probably damaging	Het
Ruvbl2	G	A	7: 45,434,317		probably benign	Het
Scn9a	T	G	2: 66,533,313	I874L	probably damaging	Het
Slc14a2	A	G	18: 78,195,736	S85P	probably benign	Het
Slc17a1	A	G	13: 23,878,811	I287V	probably benign	Het
Slc35f3	T	A	8: 126,389,189	I285N	probably damaging	Het
Slx4	A	G	16: 3,988,063	S542P	possibly damaging	Het
Sox30	A	T	11: 46,017,353	L782F	probably damaging	Het
Sspo	A	G	6: 48,455,872	N894S	probably benign	Het
Syne1	G	A	10: 5,202,013	Q5765*	probably null	Het
Taar7e	T	C	10: 24,038,074	I154T	probably benign	Het
Tars	A	G	15: 11,397,179		probably null	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem198b	A	T	10: 128,803,188	C29S	probably damaging	Het
Tnr	A	C	1: 159,895,047	M1021L	probably benign	Het
Tom1l1	G	A	11: 90,657,818	P309L	probably damaging	Het
Traf4	A	G	11: 78,161,101	S186P	probably benign	Het
Trpm1	T	G	7: 64,240,571	V974G	possibly damaging	Het
Tsga10	T	A	1: 37,841,278		probably benign	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r93	A	T	17: 18,304,019	I92F	probably damaging	Het
Zfp457	A	T	13: 67,293,901	D203E	probably benign	Het
Zfp518b	G	A	5: 38,674,158	S168F	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp777	G	A	6: 48,025,587	T523M	probably benign	Het

Other mutations in Apob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Apob	APN	12	7993065	splice site	probably benign
IGL00421:Apob	APN	12	8010197	missense	probably damaging	0.99
IGL00658:Apob	APN	12	8009471	missense	probably benign	0.08
IGL00768:Apob	APN	12	8002107	missense	probably damaging	1.00
IGL00833:Apob	APN	12	8010101	missense	probably benign	0.14
IGL00926:Apob	APN	12	8015421	missense	probably benign	0.01
IGL01065:Apob	APN	12	8003299	missense	probably damaging	0.99
IGL01313:Apob	APN	12	8000898	missense	probably damaging	1.00
IGL01419:Apob	APN	12	8002251	missense	probably damaging	0.99
IGL01461:Apob	APN	12	8001884	missense	probably benign	0.13
IGL02002:Apob	APN	12	7994822	missense	probably benign	0.03
IGL02031:Apob	APN	12	8015222	missense	probably benign
IGL02102:Apob	APN	12	7989407	missense	possibly damaging	0.94
IGL02115:Apob	APN	12	7992923	missense	probably benign	0.06
IGL02513:Apob	APN	12	7992979	missense	probably benign	0.01
IGL02967:Apob	APN	12	8015366	nonsense	probably null
IGL03005:Apob	APN	12	7993059	splice site	probably benign
IGL03011:Apob	APN	12	7997883	missense	probably damaging	1.00
IGL03116:Apob	APN	12	8016350	missense	probably damaging	0.98
IGL03215:Apob	APN	12	8013818	missense	possibly damaging	0.92
IGL03227:Apob	APN	12	8016089	missense	probably benign	0.04
Aesthete	UTSW	12	8010080	nonsense	probably null
Essence	UTSW	12	8007769	nonsense	probably null
Ethos	UTSW	12	7990394	missense	probably null	1.00
IGL02835:Apob	UTSW	12	8015097	missense	possibly damaging	0.86
IGL02837:Apob	UTSW	12	8005102	missense	probably damaging	1.00
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0116:Apob	UTSW	12	7989113	unclassified	probably benign
R0180:Apob	UTSW	12	8008285	nonsense	probably null
R0288:Apob	UTSW	12	7990779	nonsense	probably null
R0295:Apob	UTSW	12	8002181	nonsense	probably null
R0305:Apob	UTSW	12	8012210	missense	probably damaging	1.00
R0312:Apob	UTSW	12	8009034	missense	probably benign
R0324:Apob	UTSW	12	8010521	missense	probably benign	0.41
R0326:Apob	UTSW	12	7990307	missense	probably damaging	1.00
R0363:Apob	UTSW	12	8010136	missense	probably damaging	1.00
R0390:Apob	UTSW	12	7988678	missense	probably damaging	0.99
R0462:Apob	UTSW	12	8000896	missense	probably damaging	1.00
R0471:Apob	UTSW	12	7990406	missense	probably damaging	1.00
R0532:Apob	UTSW	12	8016188	missense	possibly damaging	0.48
R0548:Apob	UTSW	12	8006282	missense	probably damaging	1.00
R0560:Apob	UTSW	12	8005101	missense	probably damaging	1.00
R0595:Apob	UTSW	12	8008369	missense	probably benign	0.01
R0600:Apob	UTSW	12	8006440	missense	probably damaging	1.00
R0626:Apob	UTSW	12	8016193	missense	probably benign	0.45
R0685:Apob	UTSW	12	8010742	missense	probably benign
R0765:Apob	UTSW	12	8016518	missense	probably benign
R0790:Apob	UTSW	12	8010245	missense	probably damaging	1.00
R0918:Apob	UTSW	12	7983941	missense	probably benign	0.10
R0962:Apob	UTSW	12	7989191	missense	probably damaging	0.98
R1055:Apob	UTSW	12	7994963	missense	probably damaging	1.00
R1077:Apob	UTSW	12	8006017	missense	probably benign
R1143:Apob	UTSW	12	8012354	missense	probably benign	0.26
R1163:Apob	UTSW	12	8011654	missense	probably damaging	1.00
R1266:Apob	UTSW	12	8006093	missense	probably benign	0.37
R1434:Apob	UTSW	12	8009715	missense	probably damaging	1.00
R1442:Apob	UTSW	12	7986165	missense	probably benign	0.31
R1445:Apob	UTSW	12	8016084	missense	possibly damaging	0.48
R1459:Apob	UTSW	12	8006047	missense	probably benign
R1459:Apob	UTSW	12	8011937	missense	possibly damaging	0.92
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1508:Apob	UTSW	12	8011481	missense	possibly damaging	0.92
R1518:Apob	UTSW	12	7989207	missense	probably benign	0.01
R1531:Apob	UTSW	12	7997880	missense	possibly damaging	0.65
R1547:Apob	UTSW	12	8003368	missense	probably benign	0.08
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1682:Apob	UTSW	12	8012365	missense	probably benign	0.00
R1709:Apob	UTSW	12	8009306	missense	probably damaging	0.98
R1718:Apob	UTSW	12	8016087	missense	probably benign	0.02
R1752:Apob	UTSW	12	7988766	missense	probably benign	0.01
R1781:Apob	UTSW	12	8009603	missense	possibly damaging	0.96
R1818:Apob	UTSW	12	8006834	missense	probably damaging	0.98
R1818:Apob	UTSW	12	8013064	missense	possibly damaging	0.93
R1842:Apob	UTSW	12	8011559	missense	probably damaging	1.00
R1843:Apob	UTSW	12	8007602	missense	possibly damaging	0.65
R1853:Apob	UTSW	12	8010928	nonsense	probably null
R1990:Apob	UTSW	12	8001039	missense	probably damaging	1.00
R2016:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2017:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2023:Apob	UTSW	12	8011090	missense	probably benign	0.01
R2037:Apob	UTSW	12	8007488	missense	probably benign	0.37
R2054:Apob	UTSW	12	8013134	missense	probably damaging	1.00
R2057:Apob	UTSW	12	8002164	nonsense	probably null
R2085:Apob	UTSW	12	8012240	missense	probably damaging	1.00
R2159:Apob	UTSW	12	8010081	missense	probably benign	0.12
R2209:Apob	UTSW	12	8007752	missense	probably benign	0.28
R2249:Apob	UTSW	12	8007499	missense	probably damaging	1.00
R2254:Apob	UTSW	12	8011256	missense	possibly damaging	0.92
R2265:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2266:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2267:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2268:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2296:Apob	UTSW	12	7994879	missense	probably damaging	0.97
R2897:Apob	UTSW	12	8010356	missense	probably damaging	1.00
R3431:Apob	UTSW	12	8010778	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8006327	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8011763	missense	possibly damaging	0.46
R3899:Apob	UTSW	12	8015849	missense	possibly damaging	0.87
R4020:Apob	UTSW	12	7994914	nonsense	probably null
R4050:Apob	UTSW	12	8015390	missense	probably benign	0.02
R4351:Apob	UTSW	12	7993054	missense	probably benign	0.03
R4365:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4366:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4456:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4458:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4600:Apob	UTSW	12	8008568	missense	probably damaging	1.00
R4611:Apob	UTSW	12	8011331	missense	probably damaging	1.00
R4646:Apob	UTSW	12	8012759	missense	probably benign	0.21
R4678:Apob	UTSW	12	7995585	missense	probably damaging	1.00
R4685:Apob	UTSW	12	8006456	missense	probably benign	0.00
R4707:Apob	UTSW	12	8006205	missense	probably damaging	0.96
R4726:Apob	UTSW	12	7990267	missense	probably damaging	0.98
R4792:Apob	UTSW	12	8008051	missense	probably benign	0.26
R4822:Apob	UTSW	12	8015741	missense	probably benign	0.04
R4834:Apob	UTSW	12	8014101	missense	possibly damaging	0.49
R4835:Apob	UTSW	12	8015391	missense	possibly damaging	0.56
R4887:Apob	UTSW	12	8013099	missense	probably damaging	1.00
R4910:Apob	UTSW	12	8007848	missense	probably damaging	1.00
R5072:Apob	UTSW	12	8008714	missense	probably benign	0.00
R5073:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5074:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5101:Apob	UTSW	12	8011934	missense	probably benign	0.09
R5123:Apob	UTSW	12	8007630	splice site	probably null
R5133:Apob	UTSW	12	8008898	missense	probably damaging	0.99
R5135:Apob	UTSW	12	8010086	missense	probably damaging	1.00
R5137:Apob	UTSW	12	8011384	missense	possibly damaging	0.63
R5160:Apob	UTSW	12	8012126	missense	possibly damaging	0.90
R5173:Apob	UTSW	12	8008238	missense	probably benign	0.00
R5202:Apob	UTSW	12	8013737	missense	probably damaging	0.98
R5229:Apob	UTSW	12	7977806	missense	probably benign
R5292:Apob	UTSW	12	8005912	missense	probably benign	0.01
R5378:Apob	UTSW	12	8011865	missense	probably damaging	0.99
R5494:Apob	UTSW	12	8011762	missense	probably damaging	0.99
R5517:Apob	UTSW	12	7990906	missense	probably damaging	1.00
R5576:Apob	UTSW	12	7998662	missense	probably damaging	1.00
R5582:Apob	UTSW	12	8010788	missense	probably damaging	1.00
R5629:Apob	UTSW	12	8007847	missense	probably damaging	1.00
R5678:Apob	UTSW	12	7991494	missense	possibly damaging	0.92
R5732:Apob	UTSW	12	8010353	missense	probably benign	0.15
R5734:Apob	UTSW	12	7988781	missense	probably damaging	1.00
R5742:Apob	UTSW	12	8007191	missense	probably damaging	1.00
R5751:Apob	UTSW	12	8012619	nonsense	probably null
R5776:Apob	UTSW	12	8006149	missense	possibly damaging	0.57
R5778:Apob	UTSW	12	8015074	missense	probably benign	0.45
R5783:Apob	UTSW	12	8001022	missense	probably damaging	1.00
R5786:Apob	UTSW	12	8015304	missense	possibly damaging	0.48
R5837:Apob	UTSW	12	8003277	missense	probably benign	0.04
R5857:Apob	UTSW	12	8015397	missense	probably benign	0.00
R6029:Apob	UTSW	12	8016243	missense	probably damaging	0.99
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6086:Apob	UTSW	12	8015164	missense	probably benign
R6110:Apob	UTSW	12	8011883	missense	probably damaging	1.00
R6131:Apob	UTSW	12	8015874	missense	probably benign	0.17
R6157:Apob	UTSW	12	8006077	missense	probably benign
R6179:Apob	UTSW	12	8005060	nonsense	probably null
R6247:Apob	UTSW	12	8001801	missense	probably damaging	1.00
R6279:Apob	UTSW	12	8007769	nonsense	probably null
R6300:Apob	UTSW	12	8007769	nonsense	probably null
R6320:Apob	UTSW	12	7989194	missense	probably benign	0.27
R6339:Apob	UTSW	12	8016188	missense	probably damaging	0.99
R6353:Apob	UTSW	12	8009421	missense	probably damaging	1.00
R6395:Apob	UTSW	12	8008507	missense	probably benign	0.45
R6441:Apob	UTSW	12	7987796	missense	probably damaging	1.00
R6492:Apob	UTSW	12	8008261	missense	probably damaging	0.99
R6495:Apob	UTSW	12	7990394	missense	probably null	1.00
R6502:Apob	UTSW	12	8001814	missense	probably damaging	0.99
R6520:Apob	UTSW	12	7983124	missense	probably damaging	1.00
R6644:Apob	UTSW	12	8009077	missense	probably damaging	0.97
R6704:Apob	UTSW	12	8010379	missense	probably damaging	0.98
R6750:Apob	UTSW	12	7997853	missense	probably damaging	1.00
R6759:Apob	UTSW	12	8011049	missense	probably benign	0.06
R6812:Apob	UTSW	12	7983062	missense	probably damaging	0.98
R6865:Apob	UTSW	12	8008847	missense	probably benign	0.05
R6873:Apob	UTSW	12	8015995	missense	probably benign	0.00
R7013:Apob	UTSW	12	8010080	nonsense	probably null
R7067:Apob	UTSW	12	8009423	missense	probably damaging	1.00
R7084:Apob	UTSW	12	8009591	missense	probably benign
R7113:Apob	UTSW	12	7995539	missense	probably damaging	1.00
R7175:Apob	UTSW	12	8007034	missense	probably benign	0.33
R7196:Apob	UTSW	12	7983893	missense	possibly damaging	0.90
R7199:Apob	UTSW	12	8005072	missense	probably damaging	1.00
R7205:Apob	UTSW	12	8005087	missense	probably damaging	0.98
R7251:Apob	UTSW	12	8007037	missense	probably damaging	0.98
R7474:Apob	UTSW	12	8009185	missense	probably benign	0.29
R7484:Apob	UTSW	12	8006884	nonsense	probably null
R7538:Apob	UTSW	12	8002219	missense	probably damaging	0.98
R7636:Apob	UTSW	12	8009516	missense	possibly damaging	0.86
R7646:Apob	UTSW	12	8009189	missense	probably damaging	0.99
R7787:Apob	UTSW	12	7990780	missense	probably damaging	0.97
R7793:Apob	UTSW	12	8008124	missense	probably damaging	0.99
R7836:Apob	UTSW	12	8001885	missense	possibly damaging	0.72
R7895:Apob	UTSW	12	8011933	missense	probably benign	0.00
R8005:Apob	UTSW	12	8009744	missense	probably benign	0.01
R8013:Apob	UTSW	12	8010798	missense	possibly damaging	0.94
R8014:Apob	UTSW	12	8010798	missense	possibly damaging	0.94
R8111:Apob	UTSW	12	8008801	missense	probably benign	0.16
R8117:Apob	UTSW	12	8006435	missense	probably damaging	0.99
R8226:Apob	UTSW	12	8009056	missense	probably benign	0.00
R8244:Apob	UTSW	12	8010548	missense	probably damaging	0.96
R8280:Apob	UTSW	12	8010851	missense	possibly damaging	0.46
R8310:Apob	UTSW	12	8009033	missense	probably benign	0.00
R8327:Apob	UTSW	12	8001015	missense	possibly damaging	0.72
R8329:Apob	UTSW	12	8011135	missense	probably damaging	0.98
R8331:Apob	UTSW	12	8001882	missense	probably benign	0.28
R8351:Apob	UTSW	12	8006356	missense	probably benign	0.29
R8412:Apob	UTSW	12	8008069	missense	probably benign	0.33
R8425:Apob	UTSW	12	7988842	missense	possibly damaging	0.70
R8481:Apob	UTSW	12	7994807	splice site	probably null
R8493:Apob	UTSW	12	8009009	missense	possibly damaging	0.87
R8529:Apob	UTSW	12	8007353	missense	probably damaging	1.00
R8554:Apob	UTSW	12	7987830	missense	probably damaging	0.98
R8692:Apob	UTSW	12	8008270	missense	probably damaging	0.98
R8695:Apob	UTSW	12	8007830	missense	probably damaging	1.00
R8977:Apob	UTSW	12	8015990	missense	probably damaging	0.99
R9016:Apob	UTSW	12	7985408	splice site	silent
R9020:Apob	UTSW	12	8013999	missense	probably damaging	1.00
R9037:Apob	UTSW	12	8016501	missense	probably benign	0.15
R9053:Apob	UTSW	12	8008954	missense	possibly damaging	0.72
R9062:Apob	UTSW	12	8008046	missense	possibly damaging	0.91
R9142:Apob	UTSW	12	8012705	missense	possibly damaging	0.95
R9180:Apob	UTSW	12	7997925	missense	probably damaging	1.00
R9248:Apob	UTSW	12	8015231	nonsense	probably null
R9277:Apob	UTSW	12	8011183	missense	probably benign	0.01
R9305:Apob	UTSW	12	8008053	missense	probably benign	0.04
R9358:Apob	UTSW	12	8010833	missense	probably benign	0.14
R9375:Apob	UTSW	12	7979261	missense	possibly damaging	0.91
R9385:Apob	UTSW	12	8006399	missense	possibly damaging	0.91
R9386:Apob	UTSW	12	8006629	missense	probably damaging	0.99
R9392:Apob	UTSW	12	8007098	missense	probably benign	0.45
R9470:Apob	UTSW	12	7989219	missense	possibly damaging	0.94
R9523:Apob	UTSW	12	8002069	missense	probably damaging	1.00
R9545:Apob	UTSW	12	7983890	missense	possibly damaging	0.81
R9629:Apob	UTSW	12	8009054	missense	probably damaging	1.00
R9702:Apob	UTSW	12	8007559	missense	probably damaging	0.96
R9703:Apob	UTSW	12	7980507	missense	probably damaging	0.99
R9719:Apob	UTSW	12	8015464	missense	probably benign	0.15
R9726:Apob	UTSW	12	8006926	missense	probably damaging	0.99
R9729:Apob	UTSW	12	8016125	missense	probably damaging	0.99
X0027:Apob	UTSW	12	8007975	missense	probably benign
Z1088:Apob	UTSW	12	8005074	missense	possibly damaging	0.91
Z1088:Apob	UTSW	12	8005945	nonsense	probably null
Z1088:Apob	UTSW	12	8012936	missense	possibly damaging	0.95
Z1176:Apob	UTSW	12	7998011	missense	probably damaging	1.00
Z1176:Apob	UTSW	12	8004978	missense	probably benign	0.00
Z1177:Apob	UTSW	12	7988765	missense	probably benign	0.43
Z1177:Apob	UTSW	12	8015249	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGGGCTGCAGAAATATGTCC -3'
(R):5'- TGAAAACTTCACAGCATCCTGATC -3'

Sequencing Primer
(F):5'- CTGGGCTGCAGAAATATGTCCTATTC -3'
(R):5'- CACAGCATCCTGATCTGTGGTAAG -3'

Posted On

2022-02-07