Incidental Mutation 'R9205:Dnah11'
ID 698470
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, b2b1289Clo, b2b1203Clo, Dnahc11, avc4, b2b1279Clo, b2b1727Clo, lrd
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.661) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 117841717-118162778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 117991251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 2372 (E2372K)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: E2372K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: E2372K

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176756
AA Change: E468K

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1781 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118,162,480 (GRCm39) missense probably benign 0.28
IGL00422:Dnah11 APN 12 118,031,831 (GRCm39) missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118,000,194 (GRCm39) missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118,150,657 (GRCm39) missense probably benign 0.01
IGL00687:Dnah11 APN 12 117,885,739 (GRCm39) splice site probably benign
IGL00833:Dnah11 APN 12 118,143,315 (GRCm39) missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117,874,937 (GRCm39) missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118,160,386 (GRCm39) missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118,106,669 (GRCm39) splice site probably benign
IGL01121:Dnah11 APN 12 118,014,430 (GRCm39) missense probably benign 0.02
IGL01143:Dnah11 APN 12 117,976,475 (GRCm39) missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117,946,734 (GRCm39) missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118,156,134 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118,010,991 (GRCm39) nonsense probably null
IGL01418:Dnah11 APN 12 117,951,217 (GRCm39) nonsense probably null
IGL01444:Dnah11 APN 12 117,983,967 (GRCm39) missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117,946,767 (GRCm39) missense probably benign 0.15
IGL01645:Dnah11 APN 12 118,150,733 (GRCm39) missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118,156,005 (GRCm39) splice site probably benign
IGL02104:Dnah11 APN 12 118,156,125 (GRCm39) missense probably benign
IGL02151:Dnah11 APN 12 118,023,623 (GRCm39) splice site probably benign
IGL02189:Dnah11 APN 12 118,046,314 (GRCm39) missense probably benign 0.00
IGL02417:Dnah11 APN 12 118,020,915 (GRCm39) missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118,150,637 (GRCm39) missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117,939,608 (GRCm39) splice site probably benign
IGL02474:Dnah11 APN 12 117,991,180 (GRCm39) splice site probably null
IGL02526:Dnah11 APN 12 118,143,353 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117,874,775 (GRCm39) missense probably damaging 1.00
IGL03011:Dnah11 APN 12 117,976,112 (GRCm39) missense probably benign 0.08
IGL03061:Dnah11 APN 12 117,866,856 (GRCm39) missense probably damaging 1.00
IGL03182:Dnah11 APN 12 117,994,026 (GRCm39) missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118,069,720 (GRCm39) missense probably benign
IGL03238:Dnah11 APN 12 118,073,633 (GRCm39) missense probably damaging 1.00
IGL03493:Dnah11 APN 12 117,976,533 (GRCm39) missense probably benign 0.00
P0045:Dnah11 UTSW 12 117,994,062 (GRCm39) missense probably benign
R0009:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118,090,621 (GRCm39) missense probably benign 0.05
R0172:Dnah11 UTSW 12 117,951,188 (GRCm39) missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117,946,791 (GRCm39) nonsense probably null
R0270:Dnah11 UTSW 12 118,004,748 (GRCm39) missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118,090,868 (GRCm39) missense probably benign 0.03
R0325:Dnah11 UTSW 12 117,976,074 (GRCm39) missense probably benign
R0370:Dnah11 UTSW 12 117,958,962 (GRCm39) missense probably benign
R0416:Dnah11 UTSW 12 117,874,793 (GRCm39) missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118,070,245 (GRCm39) missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably benign 0.01
R0607:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117,951,204 (GRCm39) missense probably damaging 1.00
R0635:Dnah11 UTSW 12 117,971,731 (GRCm39) missense probably damaging 1.00
R0755:Dnah11 UTSW 12 118,162,360 (GRCm39) missense probably benign 0.17
R0755:Dnah11 UTSW 12 117,918,564 (GRCm39) missense possibly damaging 0.95
R0789:Dnah11 UTSW 12 117,874,967 (GRCm39) missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0835:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0846:Dnah11 UTSW 12 117,897,585 (GRCm39) missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118,154,579 (GRCm39) nonsense probably null
R0928:Dnah11 UTSW 12 118,009,297 (GRCm39) missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118,024,142 (GRCm39) missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117,897,547 (GRCm39) missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117,936,099 (GRCm39) missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118,020,841 (GRCm39) nonsense probably null
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1500:Dnah11 UTSW 12 117,976,564 (GRCm39) splice site probably null
R1535:Dnah11 UTSW 12 117,982,465 (GRCm39) missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117,894,991 (GRCm39) missense probably benign 0.01
R1554:Dnah11 UTSW 12 118,046,234 (GRCm39) missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R1618:Dnah11 UTSW 12 117,979,200 (GRCm39) missense probably damaging 0.98
R1638:Dnah11 UTSW 12 117,979,154 (GRCm39) missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118,084,459 (GRCm39) missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117,897,580 (GRCm39) missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118,154,603 (GRCm39) missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118,160,379 (GRCm39) missense probably benign 0.32
R1728:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118,154,560 (GRCm39) missense probably benign 0.31
R1780:Dnah11 UTSW 12 117,991,293 (GRCm39) missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118,002,515 (GRCm39) missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118,027,587 (GRCm39) missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118,091,291 (GRCm39) missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118,046,203 (GRCm39) missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118,077,606 (GRCm39) missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 117,976,451 (GRCm39) missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 117,984,088 (GRCm39) missense probably damaging 1.00
R2140:Dnah11 UTSW 12 117,972,545 (GRCm39) missense probably benign 0.01
R2261:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2261:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2262:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117,850,421 (GRCm39) missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117,892,065 (GRCm39) missense probably damaging 1.00
R2410:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117,951,162 (GRCm39) nonsense probably null
R3499:Dnah11 UTSW 12 117,874,758 (GRCm39) missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3742:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3779:Dnah11 UTSW 12 118,094,448 (GRCm39) splice site probably benign
R3785:Dnah11 UTSW 12 117,981,337 (GRCm39) missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117,942,188 (GRCm39) splice site probably benign
R4014:Dnah11 UTSW 12 117,938,649 (GRCm39) missense probably benign 0.16
R4043:Dnah11 UTSW 12 117,843,678 (GRCm39) missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118,070,227 (GRCm39) missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4074:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4076:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4201:Dnah11 UTSW 12 117,930,394 (GRCm39) missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118,094,627 (GRCm39) missense probably benign 0.06
R4233:Dnah11 UTSW 12 117,880,526 (GRCm39) missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118,089,578 (GRCm39) nonsense probably null
R4430:Dnah11 UTSW 12 117,946,746 (GRCm39) missense probably benign 0.26
R4465:Dnah11 UTSW 12 117,951,186 (GRCm39) missense probably benign 0.09
R4489:Dnah11 UTSW 12 117,880,631 (GRCm39) missense probably benign 0.31
R4572:Dnah11 UTSW 12 117,973,860 (GRCm39) missense probably benign 0.00
R4574:Dnah11 UTSW 12 117,975,990 (GRCm39) critical splice donor site probably null
R4657:Dnah11 UTSW 12 118,156,162 (GRCm39) missense probably benign 0.02
R4709:Dnah11 UTSW 12 117,982,495 (GRCm39) missense probably benign 0.26
R4740:Dnah11 UTSW 12 118,084,279 (GRCm39) missense probably benign 0.28
R4803:Dnah11 UTSW 12 118,091,343 (GRCm39) missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117,958,935 (GRCm39) missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118,090,618 (GRCm39) missense probably benign 0.37
R5018:Dnah11 UTSW 12 118,094,463 (GRCm39) missense probably benign 0.00
R5071:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5074:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5080:Dnah11 UTSW 12 118,162,565 (GRCm39) start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 117,981,435 (GRCm39) missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117,918,486 (GRCm39) missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118,121,096 (GRCm39) missense probably benign 0.09
R5252:Dnah11 UTSW 12 118,089,676 (GRCm39) missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117,847,151 (GRCm39) missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118,049,415 (GRCm39) missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117,918,628 (GRCm39) missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118,049,432 (GRCm39) missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117,844,186 (GRCm39) critical splice donor site probably null
R5546:Dnah11 UTSW 12 117,939,583 (GRCm39) missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 117,982,537 (GRCm39) missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117,847,352 (GRCm39) missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118,077,642 (GRCm39) missense probably benign 0.04
R5706:Dnah11 UTSW 12 117,987,670 (GRCm39) missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118,090,841 (GRCm39) missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118,156,125 (GRCm39) missense probably benign
R5884:Dnah11 UTSW 12 118,141,269 (GRCm39) missense probably benign 0.00
R5900:Dnah11 UTSW 12 118,046,166 (GRCm39) splice site probably null
R5905:Dnah11 UTSW 12 117,918,659 (GRCm39) missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117,878,371 (GRCm39) splice site probably null
R5973:Dnah11 UTSW 12 118,074,687 (GRCm39) missense probably benign 0.02
R6024:Dnah11 UTSW 12 117,994,007 (GRCm39) missense probably benign 0.34
R6056:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign 0.03
R6075:Dnah11 UTSW 12 118,068,586 (GRCm39) missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign
R6191:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R6197:Dnah11 UTSW 12 118,143,482 (GRCm39) missense probably benign 0.03
R6262:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117,880,590 (GRCm39) missense probably benign 0.01
R6614:Dnah11 UTSW 12 117,850,411 (GRCm39) missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118,150,617 (GRCm39) splice site probably null
R6712:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118,009,381 (GRCm39) missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118,077,629 (GRCm39) missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117,951,411 (GRCm39) splice site probably null
R6895:Dnah11 UTSW 12 117,958,926 (GRCm39) missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118,070,297 (GRCm39) missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118,162,503 (GRCm39) missense probably benign
R6945:Dnah11 UTSW 12 118,024,045 (GRCm39) missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117,897,544 (GRCm39) missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118,072,679 (GRCm39) missense probably benign 0.00
R6976:Dnah11 UTSW 12 118,162,378 (GRCm39) missense probably benign 0.16
R7000:Dnah11 UTSW 12 117,981,396 (GRCm39) missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117,885,753 (GRCm39) frame shift probably null
R7101:Dnah11 UTSW 12 118,031,880 (GRCm39) missense probably benign
R7106:Dnah11 UTSW 12 117,924,884 (GRCm39) missense probably benign 0.15
R7203:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118,090,624 (GRCm39) missense probably benign 0.00
R7219:Dnah11 UTSW 12 118,004,830 (GRCm39) missense possibly damaging 0.95
R7308:Dnah11 UTSW 12 117,959,010 (GRCm39) missense probably damaging 1.00
R7361:Dnah11 UTSW 12 117,982,477 (GRCm39) missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117,951,177 (GRCm39) missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118,089,520 (GRCm39) missense probably damaging 1.00
R7399:Dnah11 UTSW 12 117,991,212 (GRCm39) missense probably benign 0.00
R7404:Dnah11 UTSW 12 118,068,543 (GRCm39) missense probably benign 0.36
R7473:Dnah11 UTSW 12 117,866,911 (GRCm39) missense probably benign 0.19
R7545:Dnah11 UTSW 12 117,894,939 (GRCm39) missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118,104,505 (GRCm39) splice site probably null
R7625:Dnah11 UTSW 12 118,160,377 (GRCm39) missense probably benign
R7761:Dnah11 UTSW 12 117,987,648 (GRCm39) missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118,004,744 (GRCm39) missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117,951,237 (GRCm39) missense probably benign 0.04
R7904:Dnah11 UTSW 12 117,867,003 (GRCm39) missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117,930,368 (GRCm39) missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117,842,284 (GRCm39) missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 117,976,181 (GRCm39) missense probably benign
R8254:Dnah11 UTSW 12 117,842,259 (GRCm39) missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 117,991,243 (GRCm39) nonsense probably null
R8272:Dnah11 UTSW 12 118,074,752 (GRCm39) missense probably benign 0.01
R8344:Dnah11 UTSW 12 118,049,466 (GRCm39) missense probably benign 0.00
R8515:Dnah11 UTSW 12 117,939,533 (GRCm39) missense probably damaging 1.00
R8528:Dnah11 UTSW 12 117,972,538 (GRCm39) missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117,842,247 (GRCm39) missense probably benign
R8676:Dnah11 UTSW 12 118,154,539 (GRCm39) missense probably damaging 1.00
R8738:Dnah11 UTSW 12 118,049,384 (GRCm39) critical splice donor site probably null
R8773:Dnah11 UTSW 12 117,958,950 (GRCm39) missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117,874,764 (GRCm39) missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8866:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8881:Dnah11 UTSW 12 118,090,550 (GRCm39) missense probably benign 0.05
R8881:Dnah11 UTSW 12 118,077,647 (GRCm39) missense probably benign 0.00
R8920:Dnah11 UTSW 12 118,077,674 (GRCm39) missense probably damaging 0.99
R8944:Dnah11 UTSW 12 118,091,381 (GRCm39) missense possibly damaging 0.63
R8945:Dnah11 UTSW 12 117,987,718 (GRCm39) missense probably benign 0.36
R8962:Dnah11 UTSW 12 117,918,630 (GRCm39) missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117,916,273 (GRCm39) missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118,094,578 (GRCm39) missense probably benign 0.00
R9155:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9162:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9164:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117,894,918 (GRCm39) missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R9208:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117,951,095 (GRCm39) missense probably damaging 1.00
R9264:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R9290:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9291:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118,143,341 (GRCm39) missense probably benign 0.11
R9353:Dnah11 UTSW 12 118,143,434 (GRCm39) missense probably benign 0.00
R9375:Dnah11 UTSW 12 117,884,703 (GRCm39) missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118,141,290 (GRCm39) missense probably benign 0.00
R9392:Dnah11 UTSW 12 118,011,055 (GRCm39) nonsense probably null
R9433:Dnah11 UTSW 12 117,976,007 (GRCm39) missense probably damaging 1.00
R9511:Dnah11 UTSW 12 117,878,352 (GRCm39) missense probably damaging 1.00
R9526:Dnah11 UTSW 12 118,150,711 (GRCm39) missense probably damaging 0.98
R9566:Dnah11 UTSW 12 117,938,728 (GRCm39) missense possibly damaging 0.69
R9673:Dnah11 UTSW 12 117,982,513 (GRCm39) missense possibly damaging 0.91
R9705:Dnah11 UTSW 12 118,094,770 (GRCm39) missense probably damaging 1.00
R9716:Dnah11 UTSW 12 118,024,148 (GRCm39) missense probably damaging 0.99
R9746:Dnah11 UTSW 12 117,842,311 (GRCm39) nonsense probably null
R9764:Dnah11 UTSW 12 117,884,704 (GRCm39) missense probably benign 0.05
RF023:Dnah11 UTSW 12 117,918,585 (GRCm39) missense probably damaging 1.00
RF047:Dnah11 UTSW 12 117,973,818 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,858,747 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,946,704 (GRCm39) missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 118,094,534 (GRCm39) missense probably damaging 0.97
Z1176:Dnah11 UTSW 12 118,090,854 (GRCm39) missense probably benign 0.00
Z1176:Dnah11 UTSW 12 117,894,912 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTGAACTCCTAGGCTCAG -3'
(R):5'- CTCTAACTTCAACATCCCAGGG -3'

Sequencing Primer
(F):5'- CTGAACTCCTAGGCTCAGAAGAAG -3'
(R):5'- AACATCCCAGGGACACTCATTTTTC -3'
Posted On 2022-02-07