Mutagenetix > Incidental Mutation

Incidental Mutation 'R9205:Slx4'

698478

Institutional Source

Beutler Lab

Gene Symbol

Slx4

Ensembl Gene

ENSMUSG00000039738

Gene Name

SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)

Synonyms

Btbd12, D16Bwg1016e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9205 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3979105-4003770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3988063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 542 (S542P)

Ref Sequence

ENSEMBL: ENSMUSP00000038871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040790]

AlphaFold

Q6P1D7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040790
AA Change: S542P

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: S542P

Domain	Start	End	E-Value	Type
low complexity region	400	413	N/A	INTRINSIC
BTB	506	609	6.15e-7	SMART
low complexity region	651	667	N/A	INTRINSIC
low complexity region	833	849	N/A	INTRINSIC
low complexity region	857	875	N/A	INTRINSIC
low complexity region	1176	1192	N/A	INTRINSIC
low complexity region	1437	1461	N/A	INTRINSIC
Pfam:Slx4	1484	1541	3e-17	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738
AA Change: S51P

Domain	Start	End	E-Value	Type
Pfam:BTB	6	102	6.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156542

Meta Mutation Damage Score

0.1544

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.3%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp2	T	A	6: 140,642,228	H341Q	probably damaging	Het
Apob	G	A	12: 7,980,635	A125T	probably damaging	Het
Bace2	G	T	16: 97,356,859	A20S	unknown	Het
Bcar1	T	C	8: 111,715,709	Y238C	probably damaging	Het
Brinp3	A	T	1: 146,902,089	D758V	possibly damaging	Het
Btnl10	T	C	11: 58,920,519	S223P	probably damaging	Het
Cckar	C	T	5: 53,707,245		probably null	Het
Cdhr2	A	G	13: 54,713,988	N66S	probably benign	Het
Chd9	A	G	8: 91,030,642	M1890V	probably benign	Het
Col6a5	C	T	9: 105,878,638	G2196R	probably damaging	Het
Col9a1	T	G	1: 24,185,094	M119R	unknown	Het
Cryaa	A	G	17: 31,679,668	H123R	probably damaging	Het
Cux1	A	T	5: 136,370,135	D171E	probably damaging	Het
Dgkz	T	A	2: 91,933,799	T1067S	probably benign	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dnah5	T	C	15: 28,448,334	M4181T	possibly damaging	Het
Dnajb14	A	G	3: 137,908,384	E352G	possibly damaging	Het
Dnmt3l	T	A	10: 78,056,752		probably null	Het
Dph6	T	C	2: 114,569,514	I117V	probably damaging	Het
Dsg1a	A	G	18: 20,340,171	D767G	probably damaging	Het
Edn3	C	T	2: 174,761,689	P77S	possibly damaging	Het
Elmsan1	A	C	12: 84,152,887	F1020V	probably benign	Het
Fbln7	A	C	2: 128,895,248	S328R	probably null	Het
Fbn2	T	C	18: 58,059,356	R1518G	probably damaging	Het
Foxi2	A	T	7: 135,411,796	T252S	probably benign	Het
Foxred2	A	G	15: 77,952,006	S384P	probably damaging	Het
Gdpd1	G	A	11: 87,045,183	H174Y	probably benign	Het
Gm10542	A	C	18: 44,204,638	D61A	possibly damaging	Het
Gm10563	TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	4: 155,635,850		probably benign	Het
H2-Ab1	A	G	17: 34,265,007	E114G	probably damaging	Het
Htt	C	T	5: 34,819,023	T723M	probably benign	Het
Igfn1	C	T	1: 135,975,957	V348I	probably damaging	Het
Itpr1	T	A	6: 108,489,849	L2173Q	probably damaging	Het
Lamp5	A	G	2: 136,059,601	Y115C	probably damaging	Het
Lrp1	T	A	10: 127,594,981	K400*	probably null	Het
Man2a2	C	T	7: 80,361,120	V708I	probably benign	Het
Matr3	T	C	18: 35,587,721	S746P	probably benign	Het
Me1	C	T	9: 86,598,794	V353M	probably benign	Het
Nbeal1	T	A	1: 60,278,680	D1925E	probably damaging	Het
Oca2	T	A	7: 56,316,420	F387I	probably damaging	Het
Olfr1163	T	A	2: 88,070,434	H316L	probably benign	Het
Olfr181	T	G	16: 58,926,122	I150L	probably benign	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr212	T	A	6: 116,516,354	N192K	probably benign	Het
Olfr420	T	C	1: 174,158,890	I39T	probably benign	Het
Olfr912	T	A	9: 38,582,077	S267T	probably benign	Het
Opn3	G	T	1: 175,663,089	N335K	probably benign	Het
Osm	A	G	11: 4,238,504	N44D	possibly damaging	Het
Otop2	T	C	11: 115,329,086	Y251H	probably damaging	Het
Pappa	T	C	4: 65,156,375	S389P	possibly damaging	Het
Polr1d	C	T	5: 147,101,258	A19V	probably damaging	Het
Ptchd4	G	A	17: 42,503,385	V726M	probably benign	Het
Pzp	T	A	6: 128,496,663	D731V	probably benign	Het
Rgl2	A	T	17: 33,936,028	I669F	probably damaging	Het
Rpl38	T	C	11: 114,672,288	*71R	probably null	Het
Rufy1	G	A	11: 50,398,474	R514W	probably damaging	Het
Ruvbl2	G	A	7: 45,434,317		probably benign	Het
Scn9a	T	G	2: 66,533,313	I874L	probably damaging	Het
Slc14a2	A	G	18: 78,195,736	S85P	probably benign	Het
Slc17a1	A	G	13: 23,878,811	I287V	probably benign	Het
Slc35f3	T	A	8: 126,389,189	I285N	probably damaging	Het
Sox30	A	T	11: 46,017,353	L782F	probably damaging	Het
Sspo	A	G	6: 48,455,872	N894S	probably benign	Het
Syne1	G	A	10: 5,202,013	Q5765*	probably null	Het
Taar7e	T	C	10: 24,038,074	I154T	probably benign	Het
Tars	A	G	15: 11,397,179		probably null	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem198b	A	T	10: 128,803,188	C29S	probably damaging	Het
Tnr	A	C	1: 159,895,047	M1021L	probably benign	Het
Tom1l1	G	A	11: 90,657,818	P309L	probably damaging	Het
Traf4	A	G	11: 78,161,101	S186P	probably benign	Het
Trpm1	T	G	7: 64,240,571	V974G	possibly damaging	Het
Tsga10	T	A	1: 37,841,278		probably benign	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r93	A	T	17: 18,304,019	I92F	probably damaging	Het
Zfp457	A	T	13: 67,293,901	D203E	probably benign	Het
Zfp518b	G	A	5: 38,674,158	S168F	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp777	G	A	6: 48,025,587	T523M	probably benign	Het

Other mutations in Slx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Slx4	APN	16	3990888	missense	probably benign	0.17
IGL01767:Slx4	APN	16	3990248	missense	probably benign	0.01
IGL02525:Slx4	APN	16	3980597	missense	probably damaging	1.00
slim	UTSW	16	3990910	nonsense	probably null
R0033:Slx4	UTSW	16	3988000	missense	probably benign	0.08
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0363:Slx4	UTSW	16	3980089	missense	probably damaging	1.00
R0433:Slx4	UTSW	16	3986018	missense	probably benign	0.01
R0993:Slx4	UTSW	16	3985825	missense	probably benign	0.00
R1083:Slx4	UTSW	16	3990910	nonsense	probably null
R1373:Slx4	UTSW	16	3985510	missense	probably benign	0.02
R1710:Slx4	UTSW	16	3999158	missense	probably benign	0.15
R1712:Slx4	UTSW	16	3991594	missense	probably damaging	0.99
R1874:Slx4	UTSW	16	3986848	missense	probably benign	0.25
R1937:Slx4	UTSW	16	3987166	makesense	probably null
R2008:Slx4	UTSW	16	3979921	missense	probably damaging	1.00
R2156:Slx4	UTSW	16	3986359	missense	probably benign	0.00
R2427:Slx4	UTSW	16	3988987	missense	probably damaging	0.99
R3765:Slx4	UTSW	16	3980986	missense	probably damaging	1.00
R3890:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R3891:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R4465:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4467:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4497:Slx4	UTSW	16	3994909	missense	probably damaging	1.00
R4882:Slx4	UTSW	16	3980996	critical splice acceptor site	probably null
R5119:Slx4	UTSW	16	4001199	missense	possibly damaging	0.89
R5384:Slx4	UTSW	16	3990805	missense	probably damaging	1.00
R5472:Slx4	UTSW	16	3991540	missense	probably benign	0.13
R5578:Slx4	UTSW	16	3986862	missense	probably damaging	1.00
R5582:Slx4	UTSW	16	3985788	missense	possibly damaging	0.93
R5696:Slx4	UTSW	16	3979967	missense	probably damaging	1.00
R5827:Slx4	UTSW	16	4001284	missense	possibly damaging	0.94
R5964:Slx4	UTSW	16	4000951	critical splice donor site	probably null
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6345:Slx4	UTSW	16	3990850	missense	probably benign	0.06
R6612:Slx4	UTSW	16	3985276	missense	probably damaging	0.99
R6979:Slx4	UTSW	16	3985015	missense	probably damaging	0.96
R6989:Slx4	UTSW	16	3995838	missense	probably damaging	1.00
R7171:Slx4	UTSW	16	3990786	missense	probably benign
R7214:Slx4	UTSW	16	3988980	missense	probably benign	0.18
R7354:Slx4	UTSW	16	3987099	missense	probably benign	0.28
R7490:Slx4	UTSW	16	3980131	missense	possibly damaging	0.91
R7545:Slx4	UTSW	16	3999300	missense	probably benign	0.11
R7547:Slx4	UTSW	16	3985572	missense	probably benign	0.05
R7790:Slx4	UTSW	16	3986982	missense	probably benign	0.03
R8119:Slx4	UTSW	16	3985272	nonsense	probably null
R8815:Slx4	UTSW	16	3985594	missense	probably benign	0.26
R8955:Slx4	UTSW	16	3990247	missense	probably benign
R9321:Slx4	UTSW	16	3986790	missense	probably benign	0.06
R9364:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9544:Slx4	UTSW	16	3980053	missense	probably damaging	0.97
R9554:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9632:Slx4	UTSW	16	3986105	missense	probably benign	0.00
R9665:Slx4	UTSW	16	3989026	missense	probably benign	0.28
R9718:Slx4	UTSW	16	3986464	missense	possibly damaging	0.73
R9772:Slx4	UTSW	16	4000985	missense

Predicted Primers

PCR Primer
(F):5'- GCAGCACAACCTGACTTGAG -3'
(R):5'- ATATGCTTAGAGTCCATGATACCTC -3'

Sequencing Primer
(F):5'- ATGTCACCAGCTCTAAAGGCTGTG -3'
(R):5'- AGAGTCCATGATACCTCTGTCAG -3'

Posted On

2022-02-07