Incidental Mutation 'R9205:Slx4'
ID 698478
Institutional Source Beutler Lab
Gene Symbol Slx4
Ensembl Gene ENSMUSG00000039738
Gene Name SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms D16Bwg1016e, Btbd12
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 3796969-3821634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3805927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 542 (S542P)
Ref Sequence ENSEMBL: ENSMUSP00000038871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040790]
AlphaFold Q6P1D7
Predicted Effect possibly damaging
Transcript: ENSMUST00000040790
AA Change: S542P

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: S542P

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738
AA Change: S51P

DomainStartEndE-ValueType
Pfam:BTB 6 102 6.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156542
Meta Mutation Damage Score 0.1544 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Slx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3,808,752 (GRCm39) missense probably benign 0.17
IGL01767:Slx4 APN 16 3,808,112 (GRCm39) missense probably benign 0.01
IGL02525:Slx4 APN 16 3,798,461 (GRCm39) missense probably damaging 1.00
slim UTSW 16 3,808,774 (GRCm39) nonsense probably null
R0033:Slx4 UTSW 16 3,805,864 (GRCm39) missense probably benign 0.08
R0070:Slx4 UTSW 16 3,805,880 (GRCm39) missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3,805,880 (GRCm39) missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3,804,816 (GRCm39) missense probably damaging 0.99
R0242:Slx4 UTSW 16 3,804,816 (GRCm39) missense probably damaging 0.99
R0363:Slx4 UTSW 16 3,797,953 (GRCm39) missense probably damaging 1.00
R0433:Slx4 UTSW 16 3,803,882 (GRCm39) missense probably benign 0.01
R0993:Slx4 UTSW 16 3,803,689 (GRCm39) missense probably benign 0.00
R1083:Slx4 UTSW 16 3,808,774 (GRCm39) nonsense probably null
R1373:Slx4 UTSW 16 3,803,374 (GRCm39) missense probably benign 0.02
R1710:Slx4 UTSW 16 3,817,022 (GRCm39) missense probably benign 0.15
R1712:Slx4 UTSW 16 3,809,458 (GRCm39) missense probably damaging 0.99
R1874:Slx4 UTSW 16 3,804,712 (GRCm39) missense probably benign 0.25
R1937:Slx4 UTSW 16 3,805,030 (GRCm39) makesense probably null
R2008:Slx4 UTSW 16 3,797,785 (GRCm39) missense probably damaging 1.00
R2156:Slx4 UTSW 16 3,804,223 (GRCm39) missense probably benign 0.00
R2427:Slx4 UTSW 16 3,806,851 (GRCm39) missense probably damaging 0.99
R3765:Slx4 UTSW 16 3,798,850 (GRCm39) missense probably damaging 1.00
R3890:Slx4 UTSW 16 3,797,773 (GRCm39) missense probably damaging 1.00
R3891:Slx4 UTSW 16 3,797,773 (GRCm39) missense probably damaging 1.00
R4465:Slx4 UTSW 16 3,806,919 (GRCm39) missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3,806,919 (GRCm39) missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3,812,773 (GRCm39) missense probably damaging 1.00
R4882:Slx4 UTSW 16 3,798,860 (GRCm39) critical splice acceptor site probably null
R5119:Slx4 UTSW 16 3,819,063 (GRCm39) missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3,808,669 (GRCm39) missense probably damaging 1.00
R5472:Slx4 UTSW 16 3,809,404 (GRCm39) missense probably benign 0.13
R5578:Slx4 UTSW 16 3,804,726 (GRCm39) missense probably damaging 1.00
R5582:Slx4 UTSW 16 3,803,652 (GRCm39) missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3,797,831 (GRCm39) missense probably damaging 1.00
R5827:Slx4 UTSW 16 3,819,148 (GRCm39) missense possibly damaging 0.94
R5964:Slx4 UTSW 16 3,818,815 (GRCm39) critical splice donor site probably null
R6032:Slx4 UTSW 16 3,798,021 (GRCm39) missense probably damaging 1.00
R6032:Slx4 UTSW 16 3,798,021 (GRCm39) missense probably damaging 1.00
R6039:Slx4 UTSW 16 3,803,911 (GRCm39) missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3,803,911 (GRCm39) missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3,808,714 (GRCm39) missense probably benign 0.06
R6612:Slx4 UTSW 16 3,803,140 (GRCm39) missense probably damaging 0.99
R6979:Slx4 UTSW 16 3,802,879 (GRCm39) missense probably damaging 0.96
R6989:Slx4 UTSW 16 3,813,702 (GRCm39) missense probably damaging 1.00
R7171:Slx4 UTSW 16 3,808,650 (GRCm39) missense probably benign
R7214:Slx4 UTSW 16 3,806,844 (GRCm39) missense probably benign 0.18
R7354:Slx4 UTSW 16 3,804,963 (GRCm39) missense probably benign 0.28
R7490:Slx4 UTSW 16 3,797,995 (GRCm39) missense possibly damaging 0.91
R7545:Slx4 UTSW 16 3,817,164 (GRCm39) missense probably benign 0.11
R7547:Slx4 UTSW 16 3,803,436 (GRCm39) missense probably benign 0.05
R7790:Slx4 UTSW 16 3,804,846 (GRCm39) missense probably benign 0.03
R8119:Slx4 UTSW 16 3,803,136 (GRCm39) nonsense probably null
R8815:Slx4 UTSW 16 3,803,458 (GRCm39) missense probably benign 0.26
R8955:Slx4 UTSW 16 3,808,111 (GRCm39) missense probably benign
R9321:Slx4 UTSW 16 3,804,654 (GRCm39) missense probably benign 0.06
R9364:Slx4 UTSW 16 3,805,820 (GRCm39) missense probably benign 0.00
R9544:Slx4 UTSW 16 3,797,917 (GRCm39) missense probably damaging 0.97
R9554:Slx4 UTSW 16 3,805,820 (GRCm39) missense probably benign 0.00
R9632:Slx4 UTSW 16 3,803,969 (GRCm39) missense probably benign 0.00
R9665:Slx4 UTSW 16 3,806,890 (GRCm39) missense probably benign 0.28
R9718:Slx4 UTSW 16 3,804,328 (GRCm39) missense possibly damaging 0.73
R9772:Slx4 UTSW 16 3,818,849 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GCAGCACAACCTGACTTGAG -3'
(R):5'- ATATGCTTAGAGTCCATGATACCTC -3'

Sequencing Primer
(F):5'- ATGTCACCAGCTCTAAAGGCTGTG -3'
(R):5'- AGAGTCCATGATACCTCTGTCAG -3'
Posted On 2022-02-07