Incidental Mutation 'R9205:Olfr181'
ID 698479
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Name olfactory receptor 181
Synonyms MOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission
Accession Numbers

Genbank: NM_146999

Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 58924707-58928755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58926122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 150 (I150L)
Ref Sequence ENSEMBL: ENSMUSP00000074825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
AlphaFold Q8VGQ7
Predicted Effect probably benign
Transcript: ENSMUST00000075361
AA Change: I150L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: I150L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
Predicted Effect probably benign
Transcript: ENSMUST00000205742
AA Change: I150L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000205986
AA Change: I150L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,642,228 H341Q probably damaging Het
Apob G A 12: 7,980,635 A125T probably damaging Het
Bace2 G T 16: 97,356,859 A20S unknown Het
Bcar1 T C 8: 111,715,709 Y238C probably damaging Het
Brinp3 A T 1: 146,902,089 D758V possibly damaging Het
Btnl10 T C 11: 58,920,519 S223P probably damaging Het
Cckar C T 5: 53,707,245 probably null Het
Cdhr2 A G 13: 54,713,988 N66S probably benign Het
Chd9 A G 8: 91,030,642 M1890V probably benign Het
Col6a5 C T 9: 105,878,638 G2196R probably damaging Het
Col9a1 T G 1: 24,185,094 M119R unknown Het
Cryaa A G 17: 31,679,668 H123R probably damaging Het
Cux1 A T 5: 136,370,135 D171E probably damaging Het
Dgkz T A 2: 91,933,799 T1067S probably benign Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah5 T C 15: 28,448,334 M4181T possibly damaging Het
Dnajb14 A G 3: 137,908,384 E352G possibly damaging Het
Dnmt3l T A 10: 78,056,752 probably null Het
Dph6 T C 2: 114,569,514 I117V probably damaging Het
Dsg1a A G 18: 20,340,171 D767G probably damaging Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Elmsan1 A C 12: 84,152,887 F1020V probably benign Het
Fbln7 A C 2: 128,895,248 S328R probably null Het
Fbn2 T C 18: 58,059,356 R1518G probably damaging Het
Foxi2 A T 7: 135,411,796 T252S probably benign Het
Foxred2 A G 15: 77,952,006 S384P probably damaging Het
Gdpd1 G A 11: 87,045,183 H174Y probably benign Het
Gm10542 A C 18: 44,204,638 D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,635,850 probably benign Het
H2-Ab1 A G 17: 34,265,007 E114G probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Igfn1 C T 1: 135,975,957 V348I probably damaging Het
Itpr1 T A 6: 108,489,849 L2173Q probably damaging Het
Lamp5 A G 2: 136,059,601 Y115C probably damaging Het
Lrp1 T A 10: 127,594,981 K400* probably null Het
Man2a2 C T 7: 80,361,120 V708I probably benign Het
Matr3 T C 18: 35,587,721 S746P probably benign Het
Me1 C T 9: 86,598,794 V353M probably benign Het
Nbeal1 T A 1: 60,278,680 D1925E probably damaging Het
Oca2 T A 7: 56,316,420 F387I probably damaging Het
Olfr1163 T A 2: 88,070,434 H316L probably benign Het
Olfr212 T A 6: 116,516,354 N192K probably benign Het
Olfr420 T C 1: 174,158,890 I39T probably benign Het
Olfr912 T A 9: 38,582,077 S267T probably benign Het
Opn3 G T 1: 175,663,089 N335K probably benign Het
Osm A G 11: 4,238,504 N44D possibly damaging Het
Otop2 T C 11: 115,329,086 Y251H probably damaging Het
Pappa T C 4: 65,156,375 S389P possibly damaging Het
Polr1d C T 5: 147,101,258 A19V probably damaging Het
Ptchd4 G A 17: 42,503,385 V726M probably benign Het
Pzp T A 6: 128,496,663 D731V probably benign Het
Rgl2 A T 17: 33,936,028 I669F probably damaging Het
Rpl38 T C 11: 114,672,288 *71R probably null Het
Rufy1 G A 11: 50,398,474 R514W probably damaging Het
Ruvbl2 G A 7: 45,434,317 probably benign Het
Scn9a T G 2: 66,533,313 I874L probably damaging Het
Slc14a2 A G 18: 78,195,736 S85P probably benign Het
Slc17a1 A G 13: 23,878,811 I287V probably benign Het
Slc35f3 T A 8: 126,389,189 I285N probably damaging Het
Slx4 A G 16: 3,988,063 S542P possibly damaging Het
Sox30 A T 11: 46,017,353 L782F probably damaging Het
Sspo A G 6: 48,455,872 N894S probably benign Het
Syne1 G A 10: 5,202,013 Q5765* probably null Het
Taar7e T C 10: 24,038,074 I154T probably benign Het
Tars A G 15: 11,397,179 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem198b A T 10: 128,803,188 C29S probably damaging Het
Tnr A C 1: 159,895,047 M1021L probably benign Het
Tom1l1 G A 11: 90,657,818 P309L probably damaging Het
Traf4 A G 11: 78,161,101 S186P probably benign Het
Trpm1 T G 7: 64,240,571 V974G possibly damaging Het
Tsga10 T A 1: 37,841,278 probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r93 A T 17: 18,304,019 I92F probably damaging Het
Zfp457 A T 13: 67,293,901 D203E probably benign Het
Zfp518b G A 5: 38,674,158 S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp777 G A 6: 48,025,587 T523M probably benign Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2404:Olfr181 UTSW 16 58925635 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4022:Olfr181 UTSW 16 58926120 missense possibly damaging 0.94
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5109:Olfr181 UTSW 16 58926059 missense probably benign 0.10
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5477:Olfr181 UTSW 16 58926030 missense possibly damaging 0.61
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5809:Olfr181 UTSW 16 58926497 missense probably benign
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6217:Olfr181 UTSW 16 58926514 missense probably benign 0.03
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7376:Olfr181 UTSW 16 58925758 missense possibly damaging 0.82
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
R8153:Olfr181 UTSW 16 58925786 missense possibly damaging 0.47
R8947:Olfr181 UTSW 16 58926070 missense probably benign
R9205:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R9318:Olfr181 UTSW 16 58925908 missense probably damaging 1.00
R9654:Olfr181 UTSW 16 58926389 missense probably benign 0.00
R9678:Olfr181 UTSW 16 58926277 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGCAGCTGTAAGAGACCAAG -3'
(R):5'- TGTGGACAGGAGGATTTCTCTC -3'

Sequencing Primer
(F):5'- TGGTAATGGTAAAGACTTGAATTGGC -3'
(R):5'- CTCTCTATGAGTGCATGGTACAG -3'
Posted On 2022-02-07