Incidental Mutation 'R9205:Bace2'
ID 698481
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R9205 (G1)
Quality Score 161.009
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 97158059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 20 (A20S)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000047275
AA Change: A20S
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: A20S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTTGTTCAACTCTGCACC -3'
(R):5'- TCCCGATCAGCATCTCTAGG -3'

Sequencing Primer
(F):5'- TGCACCGCCTTCTCCAG -3'
(R):5'- CGATCAGCATCTCTAGGTAGTAGC -3'
Posted On 2022-02-07