Incidental Mutation 'R9205:Vmn2r93'
ID 698482
Institutional Source Beutler Lab
Gene Symbol Vmn2r93
Ensembl Gene ENSMUSG00000079698
Gene Name vomeronasal 2, receptor 93
Synonyms EG627132
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 18518543-18546703 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18524281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 92 (I92F)
Ref Sequence ENSEMBL: ENSMUSP00000078200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079206] [ENSMUST00000231879] [ENSMUST00000231938]
AlphaFold L7N1Z9
Predicted Effect probably damaging
Transcript: ENSMUST00000079206
AA Change: I92F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078200
Gene: ENSMUSG00000079698
AA Change: I92F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 453 5.9e-40 PFAM
Pfam:NCD3G 509 562 2.6e-21 PFAM
Pfam:7tm_3 594 830 1.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231879
AA Change: I92F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231938
AA Change: I92F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Vmn2r93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Vmn2r93 APN 17 18,546,504 (GRCm39) missense probably damaging 1.00
IGL01326:Vmn2r93 APN 17 18,536,906 (GRCm39) missense possibly damaging 0.92
IGL01328:Vmn2r93 APN 17 18,545,819 (GRCm39) missense probably benign 0.00
IGL01360:Vmn2r93 APN 17 18,525,510 (GRCm39) missense possibly damaging 0.71
IGL01382:Vmn2r93 APN 17 18,533,578 (GRCm39) nonsense probably null
IGL01463:Vmn2r93 APN 17 18,525,150 (GRCm39) missense probably damaging 1.00
IGL02057:Vmn2r93 APN 17 18,546,032 (GRCm39) missense probably damaging 1.00
IGL02257:Vmn2r93 APN 17 18,545,770 (GRCm39) unclassified probably benign
IGL02686:Vmn2r93 APN 17 18,533,526 (GRCm39) missense possibly damaging 0.89
IGL02720:Vmn2r93 APN 17 18,525,296 (GRCm39) missense probably damaging 1.00
IGL03328:Vmn2r93 APN 17 18,525,220 (GRCm39) missense probably damaging 1.00
PIT4576001:Vmn2r93 UTSW 17 18,533,473 (GRCm39) missense probably benign
R0067:Vmn2r93 UTSW 17 18,546,672 (GRCm39) missense probably benign 0.00
R0067:Vmn2r93 UTSW 17 18,546,672 (GRCm39) missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18,525,061 (GRCm39) missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18,525,061 (GRCm39) missense probably benign 0.00
R0488:Vmn2r93 UTSW 17 18,546,311 (GRCm39) missense probably damaging 1.00
R0667:Vmn2r93 UTSW 17 18,546,503 (GRCm39) missense probably damaging 1.00
R0668:Vmn2r93 UTSW 17 18,518,667 (GRCm39) missense probably benign 0.00
R0850:Vmn2r93 UTSW 17 18,525,279 (GRCm39) missense possibly damaging 0.93
R0924:Vmn2r93 UTSW 17 18,524,443 (GRCm39) missense probably benign
R0947:Vmn2r93 UTSW 17 18,524,343 (GRCm39) missense probably benign 0.06
R1124:Vmn2r93 UTSW 17 18,518,710 (GRCm39) missense probably benign 0.00
R1584:Vmn2r93 UTSW 17 18,525,413 (GRCm39) missense possibly damaging 0.84
R1943:Vmn2r93 UTSW 17 18,546,063 (GRCm39) missense probably benign 0.04
R2012:Vmn2r93 UTSW 17 18,536,840 (GRCm39) missense probably benign 0.01
R2018:Vmn2r93 UTSW 17 18,546,324 (GRCm39) missense probably damaging 1.00
R2196:Vmn2r93 UTSW 17 18,525,428 (GRCm39) missense probably damaging 1.00
R2373:Vmn2r93 UTSW 17 18,518,665 (GRCm39) missense probably benign
R2864:Vmn2r93 UTSW 17 18,546,323 (GRCm39) missense probably damaging 1.00
R4276:Vmn2r93 UTSW 17 18,525,092 (GRCm39) missense possibly damaging 0.47
R4446:Vmn2r93 UTSW 17 18,524,312 (GRCm39) missense possibly damaging 0.93
R4537:Vmn2r93 UTSW 17 18,525,194 (GRCm39) missense possibly damaging 0.86
R4674:Vmn2r93 UTSW 17 18,525,255 (GRCm39) missense probably benign 0.34
R4726:Vmn2r93 UTSW 17 18,536,960 (GRCm39) missense probably damaging 1.00
R4936:Vmn2r93 UTSW 17 18,524,327 (GRCm39) missense possibly damaging 0.95
R4984:Vmn2r93 UTSW 17 18,533,389 (GRCm39) splice site probably null
R5111:Vmn2r93 UTSW 17 18,546,326 (GRCm39) missense probably damaging 0.99
R5749:Vmn2r93 UTSW 17 18,518,546 (GRCm39) missense probably benign 0.06
R5918:Vmn2r93 UTSW 17 18,546,030 (GRCm39) missense probably damaging 1.00
R5921:Vmn2r93 UTSW 17 18,546,030 (GRCm39) missense probably damaging 1.00
R6091:Vmn2r93 UTSW 17 18,545,958 (GRCm39) missense probably benign 0.06
R6283:Vmn2r93 UTSW 17 18,524,366 (GRCm39) missense probably benign 0.02
R6680:Vmn2r93 UTSW 17 18,536,920 (GRCm39) nonsense probably null
R6876:Vmn2r93 UTSW 17 18,525,450 (GRCm39) missense probably benign 0.00
R6963:Vmn2r93 UTSW 17 18,536,849 (GRCm39) missense probably damaging 1.00
R6996:Vmn2r93 UTSW 17 18,524,903 (GRCm39) missense probably damaging 1.00
R7027:Vmn2r93 UTSW 17 18,533,548 (GRCm39) missense probably benign 0.01
R7034:Vmn2r93 UTSW 17 18,546,672 (GRCm39) missense probably benign 0.00
R7036:Vmn2r93 UTSW 17 18,546,672 (GRCm39) missense probably benign 0.00
R7246:Vmn2r93 UTSW 17 18,546,012 (GRCm39) missense possibly damaging 0.89
R7258:Vmn2r93 UTSW 17 18,525,403 (GRCm39) missense probably benign 0.32
R7323:Vmn2r93 UTSW 17 18,533,497 (GRCm39) nonsense probably null
R7325:Vmn2r93 UTSW 17 18,524,249 (GRCm39) missense probably benign 0.01
R7390:Vmn2r93 UTSW 17 18,525,329 (GRCm39) missense probably damaging 1.00
R7427:Vmn2r93 UTSW 17 18,546,672 (GRCm39) missense probably benign 0.00
R7428:Vmn2r93 UTSW 17 18,546,672 (GRCm39) missense probably benign 0.00
R7448:Vmn2r93 UTSW 17 18,546,248 (GRCm39) missense probably benign 0.19
R7453:Vmn2r93 UTSW 17 18,533,580 (GRCm39) missense probably benign 0.10
R7562:Vmn2r93 UTSW 17 18,518,731 (GRCm39) missense probably benign 0.01
R7662:Vmn2r93 UTSW 17 18,525,631 (GRCm39) missense probably benign 0.00
R7682:Vmn2r93 UTSW 17 18,525,583 (GRCm39) missense probably benign 0.03
R7704:Vmn2r93 UTSW 17 18,536,910 (GRCm39) missense probably benign 0.01
R7772:Vmn2r93 UTSW 17 18,533,482 (GRCm39) missense probably damaging 0.99
R7957:Vmn2r93 UTSW 17 18,545,954 (GRCm39) nonsense probably null
R8276:Vmn2r93 UTSW 17 18,525,649 (GRCm39) critical splice donor site probably null
R8290:Vmn2r93 UTSW 17 18,524,291 (GRCm39) missense probably damaging 1.00
R8362:Vmn2r93 UTSW 17 18,546,353 (GRCm39) missense probably benign 0.02
R8376:Vmn2r93 UTSW 17 18,525,230 (GRCm39) missense probably damaging 1.00
R8870:Vmn2r93 UTSW 17 18,525,320 (GRCm39) missense possibly damaging 0.91
R8925:Vmn2r93 UTSW 17 18,546,500 (GRCm39) missense probably damaging 0.99
R8927:Vmn2r93 UTSW 17 18,546,500 (GRCm39) missense probably damaging 0.99
R8954:Vmn2r93 UTSW 17 18,546,252 (GRCm39) missense probably damaging 0.99
R9038:Vmn2r93 UTSW 17 18,524,471 (GRCm39) missense probably benign
R9131:Vmn2r93 UTSW 17 18,546,143 (GRCm39) missense probably damaging 0.99
R9530:Vmn2r93 UTSW 17 18,518,562 (GRCm39) missense probably damaging 0.96
Z1088:Vmn2r93 UTSW 17 18,546,665 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r93 UTSW 17 18,525,600 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCTGTCCATTGTGAAGAAC -3'
(R):5'- GAGATGAAGTAATGTCCCAATTTGG -3'

Sequencing Primer
(F):5'- CTATACTAAGTATGTGGATGTGT -3'
(R):5'- AGATGCCATCCATGATGATCCTGTG -3'
Posted On 2022-02-07