Mutagenetix > Incidental Mutation

Incidental Mutation 'R9205:Dsg1a'

698487

Institutional Source

Beutler Lab

Gene Symbol

Dsg1a

Ensembl Gene

ENSMUSG00000069441

Gene Name

desmoglein 1 alpha

Synonyms

Dsg1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R9205 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20310811-20343350 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20340171 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 767 (D767G)

Ref Sequence

ENSEMBL: ENSMUSP00000076393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077146]

AlphaFold

Q61495

Predicted Effect

probably damaging
Transcript: ENSMUST00000077146
AA Change: D767G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: D767G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.45e-14	SMART
CA	179	267	3.11e-21	SMART
CA	290	384	6.29e-8	SMART
CA	407	485	6.44e-1	SMART
low complexity region	573	584	N/A	INTRINSIC
low complexity region	590	598	N/A	INTRINSIC
Pfam:Cadherin_C	659	781	1.6e-10	PFAM
low complexity region	786	799	N/A	INTRINSIC
internal_repeat_1	823	888	9.56e-6	PROSPERO
internal_repeat_1	908	975	9.56e-6	PROSPERO
low complexity region	983	1004	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.3%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp2	T	A	6: 140,642,228	H341Q	probably damaging	Het
Apob	G	A	12: 7,980,635	A125T	probably damaging	Het
Bace2	G	T	16: 97,356,859	A20S	unknown	Het
Bcar1	T	C	8: 111,715,709	Y238C	probably damaging	Het
Brinp3	A	T	1: 146,902,089	D758V	possibly damaging	Het
Btnl10	T	C	11: 58,920,519	S223P	probably damaging	Het
Cckar	C	T	5: 53,707,245		probably null	Het
Cdhr2	A	G	13: 54,713,988	N66S	probably benign	Het
Chd9	A	G	8: 91,030,642	M1890V	probably benign	Het
Col6a5	C	T	9: 105,878,638	G2196R	probably damaging	Het
Col9a1	T	G	1: 24,185,094	M119R	unknown	Het
Cryaa	A	G	17: 31,679,668	H123R	probably damaging	Het
Cux1	A	T	5: 136,370,135	D171E	probably damaging	Het
Dgkz	T	A	2: 91,933,799	T1067S	probably benign	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dnah5	T	C	15: 28,448,334	M4181T	possibly damaging	Het
Dnajb14	A	G	3: 137,908,384	E352G	possibly damaging	Het
Dnmt3l	T	A	10: 78,056,752		probably null	Het
Dph6	T	C	2: 114,569,514	I117V	probably damaging	Het
Edn3	C	T	2: 174,761,689	P77S	possibly damaging	Het
Elmsan1	A	C	12: 84,152,887	F1020V	probably benign	Het
Fbln7	A	C	2: 128,895,248	S328R	probably null	Het
Fbn2	T	C	18: 58,059,356	R1518G	probably damaging	Het
Foxi2	A	T	7: 135,411,796	T252S	probably benign	Het
Foxred2	A	G	15: 77,952,006	S384P	probably damaging	Het
Gdpd1	G	A	11: 87,045,183	H174Y	probably benign	Het
Gm10542	A	C	18: 44,204,638	D61A	possibly damaging	Het
Gm10563	TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	4: 155,635,850		probably benign	Het
H2-Ab1	A	G	17: 34,265,007	E114G	probably damaging	Het
Htt	C	T	5: 34,819,023	T723M	probably benign	Het
Igfn1	C	T	1: 135,975,957	V348I	probably damaging	Het
Itpr1	T	A	6: 108,489,849	L2173Q	probably damaging	Het
Lamp5	A	G	2: 136,059,601	Y115C	probably damaging	Het
Lrp1	T	A	10: 127,594,981	K400*	probably null	Het
Man2a2	C	T	7: 80,361,120	V708I	probably benign	Het
Matr3	T	C	18: 35,587,721	S746P	probably benign	Het
Me1	C	T	9: 86,598,794	V353M	probably benign	Het
Nbeal1	T	A	1: 60,278,680	D1925E	probably damaging	Het
Oca2	T	A	7: 56,316,420	F387I	probably damaging	Het
Olfr1163	T	A	2: 88,070,434	H316L	probably benign	Het
Olfr181	T	G	16: 58,926,122	I150L	probably benign	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr212	T	A	6: 116,516,354	N192K	probably benign	Het
Olfr420	T	C	1: 174,158,890	I39T	probably benign	Het
Olfr912	T	A	9: 38,582,077	S267T	probably benign	Het
Opn3	G	T	1: 175,663,089	N335K	probably benign	Het
Osm	A	G	11: 4,238,504	N44D	possibly damaging	Het
Otop2	T	C	11: 115,329,086	Y251H	probably damaging	Het
Pappa	T	C	4: 65,156,375	S389P	possibly damaging	Het
Polr1d	C	T	5: 147,101,258	A19V	probably damaging	Het
Ptchd4	G	A	17: 42,503,385	V726M	probably benign	Het
Pzp	T	A	6: 128,496,663	D731V	probably benign	Het
Rgl2	A	T	17: 33,936,028	I669F	probably damaging	Het
Rpl38	T	C	11: 114,672,288	*71R	probably null	Het
Rufy1	G	A	11: 50,398,474	R514W	probably damaging	Het
Ruvbl2	G	A	7: 45,434,317		probably benign	Het
Scn9a	T	G	2: 66,533,313	I874L	probably damaging	Het
Slc14a2	A	G	18: 78,195,736	S85P	probably benign	Het
Slc17a1	A	G	13: 23,878,811	I287V	probably benign	Het
Slc35f3	T	A	8: 126,389,189	I285N	probably damaging	Het
Slx4	A	G	16: 3,988,063	S542P	possibly damaging	Het
Sox30	A	T	11: 46,017,353	L782F	probably damaging	Het
Sspo	A	G	6: 48,455,872	N894S	probably benign	Het
Syne1	G	A	10: 5,202,013	Q5765*	probably null	Het
Taar7e	T	C	10: 24,038,074	I154T	probably benign	Het
Tars	A	G	15: 11,397,179		probably null	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem198b	A	T	10: 128,803,188	C29S	probably damaging	Het
Tnr	A	C	1: 159,895,047	M1021L	probably benign	Het
Tom1l1	G	A	11: 90,657,818	P309L	probably damaging	Het
Traf4	A	G	11: 78,161,101	S186P	probably benign	Het
Trpm1	T	G	7: 64,240,571	V974G	possibly damaging	Het
Tsga10	T	A	1: 37,841,278		probably benign	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r93	A	T	17: 18,304,019	I92F	probably damaging	Het
Zfp457	A	T	13: 67,293,901	D203E	probably benign	Het
Zfp518b	G	A	5: 38,674,158	S168F	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp777	G	A	6: 48,025,587	T523M	probably benign	Het

Other mutations in Dsg1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01064:Dsg1a	APN	18	20340206	missense	probably damaging	1.00
IGL01148:Dsg1a	APN	18	20320925	missense	probably damaging	0.97
IGL01534:Dsg1a	APN	18	20340996	missense	probably benign	0.06
IGL01566:Dsg1a	APN	18	20336783	splice site	probably benign
IGL01582:Dsg1a	APN	18	20328848	missense	probably null	1.00
IGL01913:Dsg1a	APN	18	20322236	missense	probably damaging	1.00
IGL01926:Dsg1a	APN	18	20333584	missense	possibly damaging	0.60
IGL02102:Dsg1a	APN	18	20332032	missense	probably benign	0.01
IGL02900:Dsg1a	APN	18	20328656	splice site	probably benign
IGL02937:Dsg1a	APN	18	20331534	missense	possibly damaging	0.93
IGL02962:Dsg1a	APN	18	20340324	missense	possibly damaging	0.92
IGL03003:Dsg1a	APN	18	20336819	missense	probably benign	0.43
PIT4687001:Dsg1a	UTSW	18	20331698	missense	probably benign	0.16
R0126:Dsg1a	UTSW	18	20340878	missense	probably benign	0.00
R0200:Dsg1a	UTSW	18	20340938	missense	probably benign	0.00
R0284:Dsg1a	UTSW	18	20331627	missense	probably damaging	0.98
R0394:Dsg1a	UTSW	18	20333750	missense	probably damaging	1.00
R0543:Dsg1a	UTSW	18	20340863	missense	probably damaging	1.00
R0656:Dsg1a	UTSW	18	20335892	splice site	probably benign
R0733:Dsg1a	UTSW	18	20338668	missense	probably damaging	0.97
R0750:Dsg1a	UTSW	18	20340153	missense	probably benign	0.10
R1300:Dsg1a	UTSW	18	20332149	missense	probably benign	0.19
R1501:Dsg1a	UTSW	18	20332019	missense	probably damaging	1.00
R1523:Dsg1a	UTSW	18	20322317	missense	probably damaging	0.99
R1673:Dsg1a	UTSW	18	20331504	missense	probably damaging	1.00
R1980:Dsg1a	UTSW	18	20338650	missense	probably damaging	1.00
R2102:Dsg1a	UTSW	18	20333773	missense	probably damaging	1.00
R2132:Dsg1a	UTSW	18	20340797	missense	probably damaging	1.00
R2299:Dsg1a	UTSW	18	20340150	missense	probably damaging	1.00
R2426:Dsg1a	UTSW	18	20336804	missense	probably damaging	0.96
R3031:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R4044:Dsg1a	UTSW	18	20324030	missense	probably damaging	1.00
R4075:Dsg1a	UTSW	18	20340070	missense	possibly damaging	0.53
R4644:Dsg1a	UTSW	18	20340728	missense	probably benign	0.04
R4661:Dsg1a	UTSW	18	20340533	missense	probably damaging	0.99
R4816:Dsg1a	UTSW	18	20333722	missense	probably benign	0.10
R5221:Dsg1a	UTSW	18	20324014	missense	possibly damaging	0.64
R5257:Dsg1a	UTSW	18	20320931	missense	probably damaging	1.00
R5360:Dsg1a	UTSW	18	20340954	missense	probably damaging	0.96
R5547:Dsg1a	UTSW	18	20336040	critical splice donor site	probably null
R5702:Dsg1a	UTSW	18	20336865	critical splice donor site	probably null
R5987:Dsg1a	UTSW	18	20331542	missense	probably damaging	1.00
R6108:Dsg1a	UTSW	18	20340247	missense	probably benign	0.19
R6170:Dsg1a	UTSW	18	20335986	missense	probably damaging	0.99
R7018:Dsg1a	UTSW	18	20328738	missense	possibly damaging	0.48
R7201:Dsg1a	UTSW	18	20328311	missense	probably damaging	0.98
R7730:Dsg1a	UTSW	18	20331711	missense	possibly damaging	0.77
R7814:Dsg1a	UTSW	18	20338515	splice site	probably null
R8185:Dsg1a	UTSW	18	20340612	missense	probably damaging	1.00
R8297:Dsg1a	UTSW	18	20332033	missense	probably benign	0.02
R8377:Dsg1a	UTSW	18	20333774	missense	probably damaging	1.00
R8409:Dsg1a	UTSW	18	20340151	missense	probably damaging	1.00
R8775:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8775-TAIL:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8818:Dsg1a	UTSW	18	20340542	missense	possibly damaging	0.87
R8821:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R8831:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R9030:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R9239:Dsg1a	UTSW	18	20340693	missense	probably damaging	1.00
R9410:Dsg1a	UTSW	18	20331533	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GTGCACTGTTTTAAGCAAGTTTACC -3'
(R):5'- GAAATTACTGTGGTCGTGCC -3'

Sequencing Primer
(F):5'- CAGCCTGGTCTACAAAGTGAGTTTC -3'
(R):5'- CCAAAATGTGGGGAGATGGGTG -3'

Posted On

2022-02-07