Incidental Mutation 'R9205:Slc14a2'
ID 698491
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Name solute carrier family 14 (urea transporter), member 2
Synonyms UT-A5, UT-A3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 78189363-78640157 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78238951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000126416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000025434
AA Change: S223P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: S223P

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163367
AA Change: S85P

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552
AA Change: S85P

DomainStartEndE-ValueType
Pfam:UT 1 292 3.4e-113 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78,193,653 (GRCm39) missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78,235,453 (GRCm39) missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78,197,323 (GRCm39) missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78,235,428 (GRCm39) missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78,226,745 (GRCm39) missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78,198,781 (GRCm39) missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78,252,236 (GRCm39) missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78,206,341 (GRCm39) missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78,252,302 (GRCm39) missense probably benign
xi_ning UTSW 18 78,238,962 (GRCm39) missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78,249,049 (GRCm39) start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78,235,338 (GRCm39) missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78,235,338 (GRCm39) missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78,235,338 (GRCm39) missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78,200,394 (GRCm39) nonsense probably null
R1677:Slc14a2 UTSW 18 78,206,419 (GRCm39) missense probably benign
R1749:Slc14a2 UTSW 18 78,190,295 (GRCm39) missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78,193,601 (GRCm39) splice site probably benign
R2034:Slc14a2 UTSW 18 78,226,798 (GRCm39) missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78,206,304 (GRCm39) splice site probably benign
R2278:Slc14a2 UTSW 18 78,203,159 (GRCm39) missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78,201,512 (GRCm39) nonsense probably null
R3878:Slc14a2 UTSW 18 78,202,289 (GRCm39) missense probably benign
R4086:Slc14a2 UTSW 18 78,248,998 (GRCm39) missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78,250,283 (GRCm39) missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78,250,283 (GRCm39) missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78,250,283 (GRCm39) missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78,250,283 (GRCm39) missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78,250,283 (GRCm39) missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78,250,283 (GRCm39) missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78,250,283 (GRCm39) missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78,238,962 (GRCm39) missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78,239,068 (GRCm39) missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78,239,007 (GRCm39) missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78,198,796 (GRCm39) missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78,235,403 (GRCm39) missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78,193,616 (GRCm39) missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78,238,963 (GRCm39) missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78,200,487 (GRCm39) missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78,229,055 (GRCm39) missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78,252,143 (GRCm39) missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78,202,381 (GRCm39) missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78,252,282 (GRCm39) missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78,190,229 (GRCm39) missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78,201,551 (GRCm39) missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78,252,257 (GRCm39) missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78,202,190 (GRCm39) critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78,252,309 (GRCm39) start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78,190,190 (GRCm39) missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78,197,317 (GRCm39) missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78,202,297 (GRCm39) missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78,235,389 (GRCm39) missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78,202,252 (GRCm39) missense probably damaging 0.98
R7553:Slc14a2 UTSW 18 78,198,803 (GRCm39) missense probably damaging 1.00
R7558:Slc14a2 UTSW 18 78,235,334 (GRCm39) missense probably benign 0.07
R7617:Slc14a2 UTSW 18 78,203,156 (GRCm39) missense probably benign
R7693:Slc14a2 UTSW 18 78,197,218 (GRCm39) missense possibly damaging 0.81
R7874:Slc14a2 UTSW 18 78,203,983 (GRCm39) missense probably benign 0.01
R8144:Slc14a2 UTSW 18 78,227,759 (GRCm39) critical splice donor site probably null
R9356:Slc14a2 UTSW 18 78,227,823 (GRCm39) missense probably null 0.02
Z1088:Slc14a2 UTSW 18 78,238,995 (GRCm39) missense probably damaging 1.00
Z1176:Slc14a2 UTSW 18 78,200,584 (GRCm39) missense possibly damaging 0.65
Z1176:Slc14a2 UTSW 18 78,200,583 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCAACAGATCTCTGGTAATC -3'
(R):5'- GGGGAGTTCCTCACTTTTCATC -3'

Sequencing Primer
(F):5'- TCAACAGATCTCTGGTAATCCATATC -3'
(R):5'- TCCATGGCTACAACGGG -3'
Posted On 2022-02-07