Incidental Mutation 'R9206:Dnah7a'
ID 698492
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7, LOC381341, Dnahc7a
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53436165-53745943 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 53540757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 2539 (T2539N)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: T2539N

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: T2539N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,820,330 (GRCm39) D248G probably benign Het
Abcc5 C A 16: 20,208,139 (GRCm39) V605F probably benign Het
Als2 A G 1: 59,224,406 (GRCm39) Y1066H probably damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Apex1 T G 14: 51,163,125 (GRCm39) D69E possibly damaging Het
Atg13 A T 2: 91,512,406 (GRCm39) F288I probably benign Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
Atoh1 A G 6: 64,706,713 (GRCm39) E136G probably benign Het
Ccr7 T C 11: 99,039,895 (GRCm39) N9S probably benign Het
Cdhr1 A C 14: 36,802,505 (GRCm39) W653G probably damaging Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Crnn A C 3: 93,054,251 (GRCm39) I45L possibly damaging Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fat4 G C 3: 39,063,390 (GRCm39) G4449R probably damaging Het
Fgd5 T C 6: 92,015,191 (GRCm39) L964S probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm973 A T 1: 59,591,585 (GRCm39) Q323L possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Iars2 A T 1: 185,050,146 (GRCm39) M446K possibly damaging Het
Kcnh7 A G 2: 62,607,947 (GRCm39) S545P probably damaging Het
Kif1a G T 1: 92,979,202 (GRCm39) D928E probably damaging Het
Kif26a C T 12: 112,144,480 (GRCm39) T1578M possibly damaging Het
Kif5a A G 10: 127,079,227 (GRCm39) probably null Het
Klhl31 T A 9: 77,558,389 (GRCm39) Y368* probably null Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lamc1 A T 1: 153,126,197 (GRCm39) H498Q probably damaging Het
Ltbp4 A T 7: 27,022,350 (GRCm39) C924S probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nlrp9a C A 7: 26,257,656 (GRCm39) L425M possibly damaging Het
Nop9 T A 14: 55,987,592 (GRCm39) probably null Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Nt5c3 C A 6: 56,874,793 (GRCm39) M1I probably null Het
Or4f61 A G 2: 111,922,410 (GRCm39) F212S probably benign Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rbm27 T A 18: 42,447,163 (GRCm39) Y469* probably null Het
Rbm33 A G 5: 28,557,584 (GRCm39) T266A probably damaging Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Rcor3 A T 1: 191,785,895 (GRCm39) *448R probably null Het
Scn10a T C 9: 119,445,827 (GRCm39) Y1442C probably damaging Het
Scn2a A T 2: 65,548,131 (GRCm39) I1108F probably damaging Het
Scrn2 T C 11: 96,922,962 (GRCm39) I135T probably damaging Het
Sptan1 A T 2: 29,920,724 (GRCm39) M2380L possibly damaging Het
Tbc1d12 T C 19: 38,825,442 (GRCm39) S98P probably benign Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Tor4a A T 2: 25,084,975 (GRCm39) N309K probably damaging Het
Trbv4 A G 6: 41,036,624 (GRCm39) T50A probably benign Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Tvp23b T C 11: 62,772,842 (GRCm39) I31T possibly damaging Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Vmn2r6 T A 3: 64,467,032 (GRCm39) I156F probably damaging Het
Wnk4 T C 11: 101,164,882 (GRCm39) I737T probably damaging Het
Zfp329 A T 7: 12,545,085 (GRCm39) D146E probably benign Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp804b T C 5: 6,822,154 (GRCm39) N303S probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53,458,843 (GRCm39) missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53,540,701 (GRCm39) missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53,496,905 (GRCm39) missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01322:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01357:Dnah7a APN 1 53,701,540 (GRCm39) missense probably benign
IGL01417:Dnah7a APN 1 53,623,759 (GRCm39) missense probably benign 0.01
IGL01508:Dnah7a APN 1 53,666,231 (GRCm39) missense probably benign 0.00
IGL01511:Dnah7a APN 1 53,458,754 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53,557,941 (GRCm39) missense probably benign
IGL01575:Dnah7a APN 1 53,466,979 (GRCm39) splice site probably benign
IGL01667:Dnah7a APN 1 53,586,451 (GRCm39) missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53,462,429 (GRCm39) missense probably benign 0.23
IGL01824:Dnah7a APN 1 53,543,429 (GRCm39) missense probably benign
IGL01829:Dnah7a APN 1 53,657,227 (GRCm39) missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53,623,608 (GRCm39) splice site probably benign
IGL01861:Dnah7a APN 1 53,679,508 (GRCm39) missense probably benign 0.01
IGL01984:Dnah7a APN 1 53,741,174 (GRCm39) splice site probably null
IGL02056:Dnah7a APN 1 53,543,501 (GRCm39) missense probably benign 0.17
IGL02069:Dnah7a APN 1 53,601,053 (GRCm39) splice site probably benign
IGL02072:Dnah7a APN 1 53,644,986 (GRCm39) missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53,450,739 (GRCm39) missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53,534,876 (GRCm39) missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53,476,672 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53,662,632 (GRCm39) missense probably benign 0.01
IGL02151:Dnah7a APN 1 53,512,023 (GRCm39) missense probably benign 0.08
IGL02156:Dnah7a APN 1 53,458,882 (GRCm39) missense probably benign 0.27
IGL02270:Dnah7a APN 1 53,512,052 (GRCm39) missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53,682,669 (GRCm39) missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53,564,096 (GRCm39) critical splice donor site probably null
IGL02370:Dnah7a APN 1 53,674,556 (GRCm39) missense probably benign 0.00
IGL02420:Dnah7a APN 1 53,725,702 (GRCm39) missense probably benign
IGL02458:Dnah7a APN 1 53,657,487 (GRCm39) nonsense probably null
IGL02489:Dnah7a APN 1 53,686,481 (GRCm39) missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53,657,205 (GRCm39) missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53,472,074 (GRCm39) missense probably benign 0.00
IGL02646:Dnah7a APN 1 53,564,194 (GRCm39) missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53,543,183 (GRCm39) missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53,483,631 (GRCm39) missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53,512,118 (GRCm39) splice site probably benign
IGL02874:Dnah7a APN 1 53,644,973 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53,561,519 (GRCm39) missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53,616,487 (GRCm39) missense probably benign 0.27
IGL02926:Dnah7a APN 1 53,535,109 (GRCm39) missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53,472,163 (GRCm39) missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53,644,983 (GRCm39) missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53,458,766 (GRCm39) missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53,725,773 (GRCm39) splice site probably benign
IGL03214:Dnah7a APN 1 53,561,368 (GRCm39) critical splice donor site probably null
IGL03242:Dnah7a APN 1 53,659,882 (GRCm39) missense probably benign 0.02
IGL03251:Dnah7a APN 1 53,686,433 (GRCm39) missense probably benign
IGL03265:Dnah7a APN 1 53,568,007 (GRCm39) missense probably benign
IGL03277:Dnah7a APN 1 53,669,481 (GRCm39) missense probably benign 0.00
IGL03278:Dnah7a APN 1 53,536,124 (GRCm39) missense probably benign 0.07
IGL03356:Dnah7a APN 1 53,543,093 (GRCm39) missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53,570,362 (GRCm39) missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53,496,033 (GRCm39) splice site probably null
R0051:Dnah7a UTSW 1 53,560,245 (GRCm39) splice site probably benign
R0082:Dnah7a UTSW 1 53,557,867 (GRCm39) missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53,507,843 (GRCm39) missense probably benign 0.03
R0122:Dnah7a UTSW 1 53,436,301 (GRCm39) missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53,540,685 (GRCm39) missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53,543,305 (GRCm39) missense probably benign 0.00
R0309:Dnah7a UTSW 1 53,444,849 (GRCm39) missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53,472,213 (GRCm39) missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53,543,357 (GRCm39) missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53,644,978 (GRCm39) missense probably benign 0.00
R0511:Dnah7a UTSW 1 53,536,285 (GRCm39) missense probably benign
R0576:Dnah7a UTSW 1 53,675,246 (GRCm39) missense probably benign 0.12
R0592:Dnah7a UTSW 1 53,495,771 (GRCm39) missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53,536,264 (GRCm39) missense probably benign 0.18
R0689:Dnah7a UTSW 1 53,659,840 (GRCm39) nonsense probably null
R0735:Dnah7a UTSW 1 53,583,670 (GRCm39) missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53,604,855 (GRCm39) missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53,543,238 (GRCm39) missense probably benign 0.07
R0842:Dnah7a UTSW 1 53,540,833 (GRCm39) missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53,467,019 (GRCm39) missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53,507,828 (GRCm39) missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53,686,395 (GRCm39) splice site probably benign
R1421:Dnah7a UTSW 1 53,580,032 (GRCm39) splice site probably benign
R1445:Dnah7a UTSW 1 53,567,956 (GRCm39) missense probably benign 0.02
R1473:Dnah7a UTSW 1 53,535,173 (GRCm39) missense probably benign 0.00
R1538:Dnah7a UTSW 1 53,535,148 (GRCm39) missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53,495,843 (GRCm39) missense probably benign 0.39
R1754:Dnah7a UTSW 1 53,601,059 (GRCm39) critical splice donor site probably null
R1754:Dnah7a UTSW 1 53,543,344 (GRCm39) missense probably benign 0.18
R1773:Dnah7a UTSW 1 53,472,046 (GRCm39) splice site probably null
R1779:Dnah7a UTSW 1 53,616,382 (GRCm39) missense probably benign
R1816:Dnah7a UTSW 1 53,670,901 (GRCm39) splice site probably benign
R1817:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1818:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1819:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1873:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1875:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1884:Dnah7a UTSW 1 53,580,159 (GRCm39) missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53,670,721 (GRCm39) missense probably benign
R1959:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1960:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1985:Dnah7a UTSW 1 53,543,093 (GRCm39) missense probably benign 0.01
R1992:Dnah7a UTSW 1 53,621,835 (GRCm39) missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53,621,741 (GRCm39) missense probably benign 0.00
R2074:Dnah7a UTSW 1 53,496,855 (GRCm39) missense probably benign 0.45
R2076:Dnah7a UTSW 1 53,542,968 (GRCm39) missense probably benign 0.01
R2124:Dnah7a UTSW 1 53,536,101 (GRCm39) missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53,645,034 (GRCm39) missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53,518,932 (GRCm39) missense probably benign 0.21
R2220:Dnah7a UTSW 1 53,560,333 (GRCm39) missense probably benign
R2355:Dnah7a UTSW 1 53,621,661 (GRCm39) missense probably benign 0.00
R2495:Dnah7a UTSW 1 53,645,040 (GRCm39) missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53,467,031 (GRCm39) missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53,466,983 (GRCm39) critical splice donor site probably null
R2993:Dnah7a UTSW 1 53,542,713 (GRCm39) missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53,657,275 (GRCm39) missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53,483,675 (GRCm39) missense probably benign
R3723:Dnah7a UTSW 1 53,486,505 (GRCm39) missense probably benign 0.04
R3847:Dnah7a UTSW 1 53,540,815 (GRCm39) missense probably benign 0.01
R4002:Dnah7a UTSW 1 53,670,840 (GRCm39) missense probably benign
R4009:Dnah7a UTSW 1 53,564,164 (GRCm39) missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53,464,376 (GRCm39) missense probably benign
R4193:Dnah7a UTSW 1 53,486,493 (GRCm39) missense probably benign 0.00
R4236:Dnah7a UTSW 1 53,486,524 (GRCm39) missense probably benign 0.00
R4399:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53,483,685 (GRCm39) missense probably benign 0.01
R4494:Dnah7a UTSW 1 53,488,197 (GRCm39) missense probably benign 0.01
R4569:Dnah7a UTSW 1 53,450,818 (GRCm39) missense probably benign 0.01
R4609:Dnah7a UTSW 1 53,495,816 (GRCm39) missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53,467,110 (GRCm39) missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53,486,476 (GRCm39) critical splice donor site probably null
R4781:Dnah7a UTSW 1 53,464,367 (GRCm39) missense probably benign 0.28
R4854:Dnah7a UTSW 1 53,745,888 (GRCm39) utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53,542,737 (GRCm39) missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5000:Dnah7a UTSW 1 53,606,201 (GRCm39) missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53,686,407 (GRCm39) nonsense probably null
R5026:Dnah7a UTSW 1 53,701,657 (GRCm39) missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53,536,255 (GRCm39) missense probably benign 0.01
R5119:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5151:Dnah7a UTSW 1 53,659,929 (GRCm39) missense probably benign 0.00
R5155:Dnah7a UTSW 1 53,682,654 (GRCm39) missense probably benign 0.01
R5180:Dnah7a UTSW 1 53,462,446 (GRCm39) missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53,476,768 (GRCm39) critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53,486,690 (GRCm39) splice site probably null
R5267:Dnah7a UTSW 1 53,518,851 (GRCm39) missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53,542,805 (GRCm39) missense probably benign 0.00
R5358:Dnah7a UTSW 1 53,586,331 (GRCm39) missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53,670,812 (GRCm39) missense probably benign 0.01
R5412:Dnah7a UTSW 1 53,674,503 (GRCm39) missense probably benign
R5496:Dnah7a UTSW 1 53,496,927 (GRCm39) missense probably benign
R5531:Dnah7a UTSW 1 53,458,907 (GRCm39) missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53,464,412 (GRCm39) missense probably benign
R5543:Dnah7a UTSW 1 53,543,228 (GRCm39) missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53,573,611 (GRCm39) missense probably benign 0.00
R5609:Dnah7a UTSW 1 53,621,753 (GRCm39) missense probably benign 0.03
R5643:Dnah7a UTSW 1 53,444,866 (GRCm39) missense probably benign
R5644:Dnah7a UTSW 1 53,580,138 (GRCm39) missense probably benign 0.33
R5689:Dnah7a UTSW 1 53,444,857 (GRCm39) missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53,452,937 (GRCm39) missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53,522,478 (GRCm39) missense probably benign 0.03
R5893:Dnah7a UTSW 1 53,496,944 (GRCm39) missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53,598,467 (GRCm39) missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53,659,829 (GRCm39) missense probably benign 0.00
R6102:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R6108:Dnah7a UTSW 1 53,496,004 (GRCm39) missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53,458,814 (GRCm39) missense probably benign 0.05
R6168:Dnah7a UTSW 1 53,450,727 (GRCm39) missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53,472,181 (GRCm39) missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53,458,795 (GRCm39) missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53,542,760 (GRCm39) missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53,580,273 (GRCm39) missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53,436,349 (GRCm39) missense probably benign 0.02
R6530:Dnah7a UTSW 1 53,542,856 (GRCm39) missense probably benign 0.04
R6574:Dnah7a UTSW 1 53,495,693 (GRCm39) critical splice donor site probably null
R6608:Dnah7a UTSW 1 53,564,277 (GRCm39) missense probably benign
R6625:Dnah7a UTSW 1 53,604,916 (GRCm39) missense probably benign 0.05
R6661:Dnah7a UTSW 1 53,662,609 (GRCm39) missense probably benign 0.00
R6681:Dnah7a UTSW 1 53,560,385 (GRCm39) critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53,675,221 (GRCm39) missense probably benign 0.01
R6774:Dnah7a UTSW 1 53,737,810 (GRCm39) missense probably benign
R6823:Dnah7a UTSW 1 53,495,863 (GRCm39) missense probably benign
R6900:Dnah7a UTSW 1 53,701,510 (GRCm39) missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53,670,836 (GRCm39) missense probably benign 0.09
R6956:Dnah7a UTSW 1 53,616,446 (GRCm39) missense probably benign 0.02
R6978:Dnah7a UTSW 1 53,701,526 (GRCm39) missense probably null
R6988:Dnah7a UTSW 1 53,621,784 (GRCm39) missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53,543,448 (GRCm39) missense probably benign
R7027:Dnah7a UTSW 1 53,670,665 (GRCm39) missense probably benign 0.01
R7033:Dnah7a UTSW 1 53,518,820 (GRCm39) missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53,458,912 (GRCm39) missense probably benign 0.00
R7096:Dnah7a UTSW 1 53,522,599 (GRCm39) missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53,452,927 (GRCm39) nonsense probably null
R7144:Dnah7a UTSW 1 53,737,867 (GRCm39) splice site probably null
R7167:Dnah7a UTSW 1 53,542,935 (GRCm39) missense probably benign 0.00
R7182:Dnah7a UTSW 1 53,659,620 (GRCm39) splice site probably null
R7196:Dnah7a UTSW 1 53,724,000 (GRCm39) missense probably benign 0.00
R7206:Dnah7a UTSW 1 53,737,792 (GRCm39) nonsense probably null
R7215:Dnah7a UTSW 1 53,657,509 (GRCm39) missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53,436,420 (GRCm39) missense probably benign 0.00
R7264:Dnah7a UTSW 1 53,557,973 (GRCm39) missense probably benign
R7282:Dnah7a UTSW 1 53,724,059 (GRCm39) critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53,536,297 (GRCm39) missense probably benign
R7392:Dnah7a UTSW 1 53,540,820 (GRCm39) missense probably benign 0.00
R7454:Dnah7a UTSW 1 53,557,923 (GRCm39) missense probably benign
R7471:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53,702,996 (GRCm39) missense probably benign 0.00
R7554:Dnah7a UTSW 1 53,567,857 (GRCm39) missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53,586,456 (GRCm39) missense probably benign 0.00
R7721:Dnah7a UTSW 1 53,670,842 (GRCm39) missense probably benign
R7813:Dnah7a UTSW 1 53,657,245 (GRCm39) missense probably benign
R7839:Dnah7a UTSW 1 53,606,334 (GRCm39) missense probably benign 0.08
R7959:Dnah7a UTSW 1 53,682,621 (GRCm39) missense probably benign 0.00
R7984:Dnah7a UTSW 1 53,543,377 (GRCm39) missense probably benign 0.01
R7985:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53,543,049 (GRCm39) missense probably benign
R8140:Dnah7a UTSW 1 53,540,748 (GRCm39) missense probably benign 0.02
R8184:Dnah7a UTSW 1 53,666,194 (GRCm39) missense probably benign 0.03
R8339:Dnah7a UTSW 1 53,724,178 (GRCm39) missense probably benign
R8352:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8423:Dnah7a UTSW 1 53,512,063 (GRCm39) missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53,512,112 (GRCm39) missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53,657,195 (GRCm39) missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8458:Dnah7a UTSW 1 53,657,142 (GRCm39) missense probably benign 0.01
R8493:Dnah7a UTSW 1 53,512,067 (GRCm39) missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53,657,139 (GRCm39) missense probably benign 0.01
R8502:Dnah7a UTSW 1 53,679,520 (GRCm39) missense probably benign 0.39
R8692:Dnah7a UTSW 1 53,472,175 (GRCm39) missense probably benign 0.00
R8700:Dnah7a UTSW 1 53,535,088 (GRCm39) missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53,674,476 (GRCm39) missense probably benign
R8856:Dnah7a UTSW 1 53,462,422 (GRCm39) missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53,682,682 (GRCm39) missense probably benign 0.10
R8967:Dnah7a UTSW 1 53,682,594 (GRCm39) splice site probably benign
R8982:Dnah7a UTSW 1 53,570,301 (GRCm39) missense probably benign
R8984:Dnah7a UTSW 1 53,674,436 (GRCm39) nonsense probably null
R8993:Dnah7a UTSW 1 53,543,262 (GRCm39) missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53,701,501 (GRCm39) missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53,512,116 (GRCm39) critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53,560,297 (GRCm39) missense probably benign 0.00
R9077:Dnah7a UTSW 1 53,741,218 (GRCm39) missense unknown
R9167:Dnah7a UTSW 1 53,657,370 (GRCm39) missense probably benign 0.00
R9226:Dnah7a UTSW 1 53,560,326 (GRCm39) missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53,621,671 (GRCm39) missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53,674,505 (GRCm39) missense probably benign
R9350:Dnah7a UTSW 1 53,436,307 (GRCm39) missense probably benign 0.19
R9369:Dnah7a UTSW 1 53,564,222 (GRCm39) missense possibly damaging 0.72
R9369:Dnah7a UTSW 1 53,543,421 (GRCm39) missense probably benign
R9372:Dnah7a UTSW 1 53,543,474 (GRCm39) missense probably benign
R9376:Dnah7a UTSW 1 53,568,058 (GRCm39) critical splice acceptor site probably null
R9378:Dnah7a UTSW 1 53,621,776 (GRCm39) missense probably benign 0.32
R9401:Dnah7a UTSW 1 53,568,026 (GRCm39) missense probably benign 0.01
R9431:Dnah7a UTSW 1 53,450,812 (GRCm39) missense possibly damaging 0.90
R9529:Dnah7a UTSW 1 53,561,495 (GRCm39) missense probably damaging 1.00
R9701:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
R9712:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R9799:Dnah7a UTSW 1 53,557,968 (GRCm39) missense probably benign 0.00
R9802:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
X0027:Dnah7a UTSW 1 53,512,089 (GRCm39) missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53,507,802 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,522,622 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53,598,261 (GRCm39) missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53,450,815 (GRCm39) missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53,682,616 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACTCTGTAAGCACTGACTCCC -3'
(R):5'- CAGCAGTGACAAGATCATATTACCC -3'

Sequencing Primer
(F):5'- CACATTTGTTTGCACCATTGTTATG -3'
(R):5'- GTGACAAGATCATATTACCCACCTTG -3'
Posted On 2022-02-07