Mutagenetix > Incidental Mutation

Incidental Mutation 'R9206:Kif1a'

698495

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

MMRRC Submission

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Essential gene?

Probably essential (E-score: 0.819) question?

Stock #

R9206 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 93051480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 928 (D928E)

Ref Sequence

ENSEMBL: ENSMUSP00000140163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000086819

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112958

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171556

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171796

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186828

Predicted Effect

probably damaging
Transcript: ENSMUST00000190723
AA Change: D928E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: D928E

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	G	17: 45,509,404	D248G	probably benign	Het
Abcc5	C	A	16: 20,389,389	V605F	probably benign	Het
AI314180	A	T	4: 58,875,444	D173E	probably damaging	Het
Als2	A	G	1: 59,185,247	Y1066H	probably damaging	Het
Apbb1	A	G	7: 105,559,520	S569P	probably damaging	Het
Apex1	T	G	14: 50,925,668	D69E	possibly damaging	Het
Atg13	A	T	2: 91,682,061	F288I	probably benign	Het
Atl3	A	G	19: 7,510,082	I121V	probably benign	Het
Atoh1	A	G	6: 64,729,729	E136G	probably benign	Het
Ccr7	T	C	11: 99,149,069	N9S	probably benign	Het
Cdhr1	A	C	14: 37,080,548	W653G	probably damaging	Het
Cln6	T	A	9: 62,849,183	M203K	probably benign	Het
Crnn	A	C	3: 93,146,944	I45L	possibly damaging	Het
Cse1l	C	A	2: 166,941,265	N743K	probably damaging	Het
Cyp1a2	A	G	9: 57,682,300	I77T	probably damaging	Het
D6Wsu163e	A	G	6: 126,966,969	I443V	probably benign	Het
Dnah7a	G	T	1: 53,501,598	T2539N	probably benign	Het
Fam13c	A	G	10: 70,553,039	E465G	probably damaging	Het
Fat4	G	C	3: 39,009,241	G4449R	probably damaging	Het
Fgd5	T	C	6: 92,038,210	L964S	probably damaging	Het
Fpr3	A	T	17: 17,970,869	Q134L	probably damaging	Het
Gm973	A	T	1: 59,552,426	Q323L	possibly damaging	Het
Gna15	A	G	10: 81,509,390	S214P	probably benign	Het
Iars2	A	T	1: 185,317,949	M446K	possibly damaging	Het
Kcnh7	A	G	2: 62,777,603	S545P	probably damaging	Het
Kif26a	C	T	12: 112,178,046	T1578M	possibly damaging	Het
Kif5a	A	G	10: 127,243,358		probably null	Het
Klhl31	T	A	9: 77,651,107	Y368*	probably null	Het
Krtap27-1	A	G	16: 88,671,428	V76A	possibly damaging	Het
Lamc1	A	T	1: 153,250,451	H498Q	probably damaging	Het
Ltbp4	A	T	7: 27,322,925	C924S	probably damaging	Het
Ltn1	T	C	16: 87,400,410	D1180G	probably benign	Het
Macf1	A	G	4: 123,684,132	C20R	unknown	Het
Mpp7	T	C	18: 7,403,327	R328G	probably benign	Het
Ncdn	A	T	4: 126,750,248	D260E	probably benign	Het
Nlrp9a	C	A	7: 26,558,231	L425M	possibly damaging	Het
Nop9	T	A	14: 55,750,135		probably null	Het
Nrip1	T	C	16: 76,292,728	E647G	possibly damaging	Het
Nt5c3	C	A	6: 56,897,808	M1I	probably null	Het
Olfr1314	A	G	2: 112,092,065	F212S	probably benign	Het
Olfr69	A	G	7: 103,768,271	I42T	probably benign	Het
Olfr892-ps1	T	C	9: 38,189,824	M33T	possibly damaging	Het
Patj	A	T	4: 98,539,073	I172F	unknown	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Ptprd	C	G	4: 75,954,078	A1134P	possibly damaging	Het
Rbm27	T	A	18: 42,314,098	Y469*	probably null	Het
Rbm33	A	G	5: 28,352,586	T266A	probably damaging	Het
Rcbtb2	C	T	14: 73,177,060	S437L	probably damaging	Het
Rcor3	A	T	1: 192,101,595	*448R	probably null	Het
Scn10a	T	C	9: 119,616,761	Y1442C	probably damaging	Het
Scn2a	A	T	2: 65,717,787	I1108F	probably damaging	Het
Scrn2	T	C	11: 97,032,136	I135T	probably damaging	Het
Sptan1	A	T	2: 30,030,712	M2380L	possibly damaging	Het
Tbc1d12	T	C	19: 38,836,998	S98P	probably benign	Het
Tmem106b	A	T	6: 13,082,431	T202S	probably damaging	Het
Tnfsf8	A	G	4: 63,834,213	V205A	probably benign	Het
Tor4a	A	T	2: 25,194,963	N309K	probably damaging	Het
Trbv4	A	G	6: 41,059,690	T50A	probably benign	Het
Tspyl4	A	G	10: 34,297,572	H20R	probably benign	Het
Tvp23b	T	C	11: 62,882,016	I31T	possibly damaging	Het
Vmn1r192	A	T	13: 22,187,231	F273Y	probably damaging	Het
Vmn2r6	T	A	3: 64,559,611	I156F	probably damaging	Het
Wnk4	T	C	11: 101,274,056	I737T	probably damaging	Het
Zfp329	A	T	7: 12,811,158	D146E	probably benign	Het
Zfp40	A	G	17: 23,175,577	F679L	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp804b	T	C	5: 6,772,154	N303S	probably benign	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
asbestos	UTSW	1	93022505	missense	probably damaging	1.00
chrysolite	UTSW	1	93074948	splice site	probably benign
osmium	UTSW	1	93058810	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93077047	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93082406	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	93046729	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93078835	missense	probably damaging	0.99
R4794:Kif1a	UTSW	1	93025727	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	splice site	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	93018498	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47
R7022:Kif1a	UTSW	1	93066098	missense	probably benign	0.31
R7059:Kif1a	UTSW	1	93046829	intron	probably benign
R7103:Kif1a	UTSW	1	93077785	missense	probably damaging	1.00
R7248:Kif1a	UTSW	1	93041583	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93073810	nonsense	probably null
R7424:Kif1a	UTSW	1	93054317	missense	possibly damaging	0.89
R7659:Kif1a	UTSW	1	93046820	intron	probably benign
R7681:Kif1a	UTSW	1	93054944	missense	probably benign
R7976:Kif1a	UTSW	1	93039774	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	93054701	intron	probably benign
R8420:Kif1a	UTSW	1	93022419	missense	probably benign
R8994:Kif1a	UTSW	1	93055735	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	93025673	missense	probably damaging	1.00
R9246:Kif1a	UTSW	1	93077779	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93075054	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93072307	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	93021297	missense	probably benign	0.00
R9612:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R9621:Kif1a	UTSW	1	93055723	missense	probably benign
R9625:Kif1a	UTSW	1	93073044	missense	probably benign	0.42
R9694:Kif1a	UTSW	1	93022451	missense	probably benign
Z1176:Kif1a	UTSW	1	93021316	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	93022491	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	93055697	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCCAGGGCATCTATCTCCTAC -3'
(R):5'- CTCAACACATGCATGAGCGAG -3'

Sequencing Primer
(F):5'- AGGGCATCTATCTCCTACATGTG -3'
(R):5'- ATGAGCGAGCGCATGGC -3'

Posted On

2022-02-07