Incidental Mutation 'R9206:Kif1a'
ID 698495
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Name kinesin family member 1A
Synonyms N-3 kinesin, C630002N23Rik, Kns1, LOC381283, ATSV
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.846) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 92943186-93029673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 92979202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 928 (D928E)
Ref Sequence ENSEMBL: ENSMUSP00000140163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000086819
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112958
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171556
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171796
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186828
Predicted Effect probably damaging
Transcript: ENSMUST00000190723
AA Change: D928E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: D928E

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,820,330 (GRCm39) D248G probably benign Het
Abcc5 C A 16: 20,208,139 (GRCm39) V605F probably benign Het
Als2 A G 1: 59,224,406 (GRCm39) Y1066H probably damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Apex1 T G 14: 51,163,125 (GRCm39) D69E possibly damaging Het
Atg13 A T 2: 91,512,406 (GRCm39) F288I probably benign Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
Atoh1 A G 6: 64,706,713 (GRCm39) E136G probably benign Het
Ccr7 T C 11: 99,039,895 (GRCm39) N9S probably benign Het
Cdhr1 A C 14: 36,802,505 (GRCm39) W653G probably damaging Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Crnn A C 3: 93,054,251 (GRCm39) I45L possibly damaging Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dnah7a G T 1: 53,540,757 (GRCm39) T2539N probably benign Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fat4 G C 3: 39,063,390 (GRCm39) G4449R probably damaging Het
Fgd5 T C 6: 92,015,191 (GRCm39) L964S probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm973 A T 1: 59,591,585 (GRCm39) Q323L possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Iars2 A T 1: 185,050,146 (GRCm39) M446K possibly damaging Het
Kcnh7 A G 2: 62,607,947 (GRCm39) S545P probably damaging Het
Kif26a C T 12: 112,144,480 (GRCm39) T1578M possibly damaging Het
Kif5a A G 10: 127,079,227 (GRCm39) probably null Het
Klhl31 T A 9: 77,558,389 (GRCm39) Y368* probably null Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lamc1 A T 1: 153,126,197 (GRCm39) H498Q probably damaging Het
Ltbp4 A T 7: 27,022,350 (GRCm39) C924S probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nlrp9a C A 7: 26,257,656 (GRCm39) L425M possibly damaging Het
Nop9 T A 14: 55,987,592 (GRCm39) probably null Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Nt5c3 C A 6: 56,874,793 (GRCm39) M1I probably null Het
Or4f61 A G 2: 111,922,410 (GRCm39) F212S probably benign Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rbm27 T A 18: 42,447,163 (GRCm39) Y469* probably null Het
Rbm33 A G 5: 28,557,584 (GRCm39) T266A probably damaging Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Rcor3 A T 1: 191,785,895 (GRCm39) *448R probably null Het
Scn10a T C 9: 119,445,827 (GRCm39) Y1442C probably damaging Het
Scn2a A T 2: 65,548,131 (GRCm39) I1108F probably damaging Het
Scrn2 T C 11: 96,922,962 (GRCm39) I135T probably damaging Het
Sptan1 A T 2: 29,920,724 (GRCm39) M2380L possibly damaging Het
Tbc1d12 T C 19: 38,825,442 (GRCm39) S98P probably benign Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Tor4a A T 2: 25,084,975 (GRCm39) N309K probably damaging Het
Trbv4 A G 6: 41,036,624 (GRCm39) T50A probably benign Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Tvp23b T C 11: 62,772,842 (GRCm39) I31T possibly damaging Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Vmn2r6 T A 3: 64,467,032 (GRCm39) I156F probably damaging Het
Wnk4 T C 11: 101,164,882 (GRCm39) I737T probably damaging Het
Zfp329 A T 7: 12,545,085 (GRCm39) D146E probably benign Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp804b T C 5: 6,822,154 (GRCm39) N303S probably benign Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 92,982,656 (GRCm39) missense probably damaging 1.00
IGL01574:Kif1a APN 1 93,010,062 (GRCm39) missense probably damaging 1.00
IGL01637:Kif1a APN 1 92,967,575 (GRCm39) missense possibly damaging 0.95
IGL01895:Kif1a APN 1 92,953,455 (GRCm39) missense possibly damaging 0.65
IGL02215:Kif1a APN 1 92,948,271 (GRCm39) missense probably benign 0.05
IGL02571:Kif1a APN 1 92,948,178 (GRCm39) critical splice donor site probably null
IGL02734:Kif1a APN 1 92,990,280 (GRCm39) missense probably damaging 1.00
IGL02752:Kif1a APN 1 92,967,569 (GRCm39) missense possibly damaging 0.92
IGL02990:Kif1a APN 1 92,966,985 (GRCm39) missense probably damaging 1.00
IGL03298:Kif1a APN 1 92,993,903 (GRCm39) missense probably damaging 1.00
IGL03309:Kif1a APN 1 92,986,579 (GRCm39) nonsense probably null
IGL03354:Kif1a APN 1 92,987,957 (GRCm39) missense probably damaging 1.00
asbestos UTSW 1 92,950,227 (GRCm39) missense probably damaging 1.00
chrysolite UTSW 1 93,002,670 (GRCm39) splice site probably benign
osmium UTSW 1 92,986,532 (GRCm39) splice site probably benign
R4538_Kif1a_397 UTSW 1 93,004,769 (GRCm39) missense probably damaging 1.00
1mM(1):Kif1a UTSW 1 93,004,790 (GRCm39) missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93,010,128 (GRCm39) missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 92,974,451 (GRCm39) missense probably damaging 1.00
R0025:Kif1a UTSW 1 92,970,080 (GRCm39) missense probably damaging 1.00
R0115:Kif1a UTSW 1 92,974,500 (GRCm39) splice site probably benign
R0243:Kif1a UTSW 1 92,969,815 (GRCm39) missense probably damaging 1.00
R0270:Kif1a UTSW 1 92,982,164 (GRCm39) splice site probably benign
R0335:Kif1a UTSW 1 92,980,288 (GRCm39) splice site probably benign
R0380:Kif1a UTSW 1 92,983,753 (GRCm39) critical splice acceptor site probably null
R0472:Kif1a UTSW 1 92,946,719 (GRCm39) missense probably damaging 0.99
R0501:Kif1a UTSW 1 92,983,967 (GRCm39) missense probably damaging 1.00
R0538:Kif1a UTSW 1 92,971,360 (GRCm39) missense probably damaging 0.99
R0628:Kif1a UTSW 1 92,947,605 (GRCm39) missense probably damaging 1.00
R0848:Kif1a UTSW 1 92,947,620 (GRCm39) missense probably damaging 1.00
R1110:Kif1a UTSW 1 92,951,175 (GRCm39) splice site probably benign
R1132:Kif1a UTSW 1 92,983,743 (GRCm39) missense probably damaging 0.99
R1387:Kif1a UTSW 1 92,983,672 (GRCm39) splice site probably benign
R1466:Kif1a UTSW 1 92,982,651 (GRCm39) missense possibly damaging 0.68
R1466:Kif1a UTSW 1 92,982,651 (GRCm39) missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93,002,670 (GRCm39) splice site probably benign
R1569:Kif1a UTSW 1 92,986,532 (GRCm39) splice site probably benign
R1802:Kif1a UTSW 1 92,993,871 (GRCm39) missense probably damaging 1.00
R1917:Kif1a UTSW 1 92,946,753 (GRCm39) missense possibly damaging 0.95
R1919:Kif1a UTSW 1 92,946,753 (GRCm39) missense possibly damaging 0.95
R1999:Kif1a UTSW 1 92,988,517 (GRCm39) missense probably damaging 0.98
R2000:Kif1a UTSW 1 92,982,051 (GRCm39) missense probably damaging 0.99
R2276:Kif1a UTSW 1 92,996,199 (GRCm39) splice site probably benign
R2307:Kif1a UTSW 1 93,006,491 (GRCm39) missense probably damaging 1.00
R2919:Kif1a UTSW 1 92,974,464 (GRCm39) missense probably damaging 1.00
R3440:Kif1a UTSW 1 92,964,575 (GRCm39) missense possibly damaging 0.53
R3441:Kif1a UTSW 1 92,964,575 (GRCm39) missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93,004,765 (GRCm39) missense probably null 1.00
R3957:Kif1a UTSW 1 92,953,416 (GRCm39) missense probably damaging 1.00
R4010:Kif1a UTSW 1 92,950,131 (GRCm39) missense probably benign 0.42
R4013:Kif1a UTSW 1 93,004,014 (GRCm39) missense probably damaging 1.00
R4017:Kif1a UTSW 1 93,004,014 (GRCm39) missense probably damaging 1.00
R4115:Kif1a UTSW 1 92,980,260 (GRCm39) missense probably damaging 1.00
R4386:Kif1a UTSW 1 92,996,272 (GRCm39) missense probably damaging 1.00
R4538:Kif1a UTSW 1 93,004,769 (GRCm39) missense probably damaging 1.00
R4608:Kif1a UTSW 1 92,952,368 (GRCm39) missense possibly damaging 0.81
R4625:Kif1a UTSW 1 92,970,381 (GRCm39) missense probably benign 0.00
R4701:Kif1a UTSW 1 93,006,557 (GRCm39) missense probably damaging 0.99
R4794:Kif1a UTSW 1 92,953,449 (GRCm39) missense probably damaging 1.00
R4830:Kif1a UTSW 1 92,948,931 (GRCm39) splice site probably null
R4903:Kif1a UTSW 1 92,949,456 (GRCm39) missense probably damaging 1.00
R4915:Kif1a UTSW 1 93,002,700 (GRCm39) missense probably benign 0.21
R4918:Kif1a UTSW 1 93,002,700 (GRCm39) missense probably benign 0.21
R4991:Kif1a UTSW 1 93,006,530 (GRCm39) missense probably benign 0.00
R5028:Kif1a UTSW 1 92,982,049 (GRCm39) missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93,003,876 (GRCm39) splice site probably null
R5073:Kif1a UTSW 1 92,950,227 (GRCm39) missense probably damaging 1.00
R5103:Kif1a UTSW 1 92,974,418 (GRCm39) missense probably damaging 1.00
R5314:Kif1a UTSW 1 92,946,220 (GRCm39) missense probably damaging 1.00
R5481:Kif1a UTSW 1 92,987,966 (GRCm39) missense probably benign 0.01
R5510:Kif1a UTSW 1 92,969,414 (GRCm39) missense possibly damaging 0.93
R5610:Kif1a UTSW 1 92,953,450 (GRCm39) missense probably damaging 1.00
R5643:Kif1a UTSW 1 92,983,489 (GRCm39) missense probably damaging 0.98
R5808:Kif1a UTSW 1 92,970,420 (GRCm39) missense probably damaging 0.99
R6027:Kif1a UTSW 1 92,953,365 (GRCm39) missense probably benign 0.33
R6056:Kif1a UTSW 1 92,952,370 (GRCm39) missense probably damaging 1.00
R6077:Kif1a UTSW 1 92,982,618 (GRCm39) missense possibly damaging 0.54
R6120:Kif1a UTSW 1 92,952,296 (GRCm39) splice site probably null
R6126:Kif1a UTSW 1 92,947,621 (GRCm39) missense probably damaging 1.00
R6130:Kif1a UTSW 1 92,964,623 (GRCm39) missense probably damaging 1.00
R6255:Kif1a UTSW 1 92,947,705 (GRCm39) missense probably damaging 1.00
R6301:Kif1a UTSW 1 92,982,663 (GRCm39) nonsense probably null
R6326:Kif1a UTSW 1 93,004,048 (GRCm39) missense probably damaging 1.00
R6594:Kif1a UTSW 1 92,949,035 (GRCm39) missense probably benign 0.00
R6653:Kif1a UTSW 1 93,005,420 (GRCm39) missense probably damaging 1.00
R6791:Kif1a UTSW 1 92,993,859 (GRCm39) missense probably damaging 1.00
R6853:Kif1a UTSW 1 92,967,524 (GRCm39) missense possibly damaging 0.47
R7022:Kif1a UTSW 1 92,993,820 (GRCm39) missense probably benign 0.31
R7059:Kif1a UTSW 1 92,974,551 (GRCm39) intron probably benign
R7103:Kif1a UTSW 1 93,005,507 (GRCm39) missense probably damaging 1.00
R7248:Kif1a UTSW 1 92,969,305 (GRCm39) missense probably benign 0.35
R7259:Kif1a UTSW 1 93,001,532 (GRCm39) nonsense probably null
R7424:Kif1a UTSW 1 92,982,039 (GRCm39) missense possibly damaging 0.89
R7659:Kif1a UTSW 1 92,974,542 (GRCm39) intron probably benign
R7681:Kif1a UTSW 1 92,982,666 (GRCm39) missense probably benign
R7976:Kif1a UTSW 1 92,967,496 (GRCm39) missense probably damaging 1.00
R8056:Kif1a UTSW 1 92,982,423 (GRCm39) intron probably benign
R8420:Kif1a UTSW 1 92,950,141 (GRCm39) missense probably benign
R8994:Kif1a UTSW 1 92,983,457 (GRCm39) missense possibly damaging 0.77
R9016:Kif1a UTSW 1 92,953,395 (GRCm39) missense probably damaging 1.00
R9246:Kif1a UTSW 1 93,005,501 (GRCm39) missense probably damaging 0.98
R9252:Kif1a UTSW 1 93,002,776 (GRCm39) missense probably damaging 1.00
R9388:Kif1a UTSW 1 93,000,029 (GRCm39) critical splice donor site probably null
R9413:Kif1a UTSW 1 92,949,019 (GRCm39) missense probably benign 0.00
R9612:Kif1a UTSW 1 92,953,416 (GRCm39) missense probably damaging 1.00
R9621:Kif1a UTSW 1 92,983,445 (GRCm39) missense probably benign
R9625:Kif1a UTSW 1 93,000,766 (GRCm39) missense probably benign 0.42
R9694:Kif1a UTSW 1 92,950,173 (GRCm39) missense probably benign
Z1176:Kif1a UTSW 1 92,950,213 (GRCm39) missense probably damaging 1.00
Z1176:Kif1a UTSW 1 92,949,038 (GRCm39) missense probably damaging 0.97
Z1176:Kif1a UTSW 1 92,983,419 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCAGGGCATCTATCTCCTAC -3'
(R):5'- CTCAACACATGCATGAGCGAG -3'

Sequencing Primer
(F):5'- AGGGCATCTATCTCCTACATGTG -3'
(R):5'- ATGAGCGAGCGCATGGC -3'
Posted On 2022-02-07