Incidental Mutation 'R9206:Fat4'
ID 698506
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 38886940-39011985 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 39009241 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 4449 (G4449R)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061260
AA Change: G4449R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: G4449R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 (GRCm38) D248G probably benign Het
Abcc5 C A 16: 20,389,389 (GRCm38) V605F probably benign Het
AI314180 A T 4: 58,875,444 (GRCm38) D173E probably damaging Het
Als2 A G 1: 59,185,247 (GRCm38) Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 (GRCm38) S569P probably damaging Het
Apex1 T G 14: 50,925,668 (GRCm38) D69E possibly damaging Het
Atg13 A T 2: 91,682,061 (GRCm38) F288I probably benign Het
Atl3 A G 19: 7,510,082 (GRCm38) I121V probably benign Het
Atoh1 A G 6: 64,729,729 (GRCm38) E136G probably benign Het
Ccr7 T C 11: 99,149,069 (GRCm38) N9S probably benign Het
Cdhr1 A C 14: 37,080,548 (GRCm38) W653G probably damaging Het
Cln6 T A 9: 62,849,183 (GRCm38) M203K probably benign Het
Crnn A C 3: 93,146,944 (GRCm38) I45L possibly damaging Het
Cse1l C A 2: 166,941,265 (GRCm38) N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 (GRCm38) I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 (GRCm38) I443V probably benign Het
Dnah7a G T 1: 53,501,598 (GRCm38) T2539N probably benign Het
Fam13c A G 10: 70,553,039 (GRCm38) E465G probably damaging Het
Fgd5 T C 6: 92,038,210 (GRCm38) L964S probably damaging Het
Fpr3 A T 17: 17,970,869 (GRCm38) Q134L probably damaging Het
Gm973 A T 1: 59,552,426 (GRCm38) Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 (GRCm38) S214P probably benign Het
Iars2 A T 1: 185,317,949 (GRCm38) M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 (GRCm38) S545P probably damaging Het
Kif1a G T 1: 93,051,480 (GRCm38) D928E probably damaging Het
Kif26a C T 12: 112,178,046 (GRCm38) T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 (GRCm38) probably null Het
Klhl31 T A 9: 77,651,107 (GRCm38) Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 (GRCm38) V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 (GRCm38) H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 (GRCm38) C924S probably damaging Het
Ltn1 T C 16: 87,400,410 (GRCm38) D1180G probably benign Het
Macf1 A G 4: 123,684,132 (GRCm38) C20R unknown Het
Mpp7 T C 18: 7,403,327 (GRCm38) R328G probably benign Het
Ncdn A T 4: 126,750,248 (GRCm38) D260E probably benign Het
Nlrp9a C A 7: 26,558,231 (GRCm38) L425M possibly damaging Het
Nop9 T A 14: 55,750,135 (GRCm38) probably null Het
Nrip1 T C 16: 76,292,728 (GRCm38) E647G possibly damaging Het
Nt5c3 C A 6: 56,897,808 (GRCm38) M1I probably null Het
Olfr1314 A G 2: 112,092,065 (GRCm38) F212S probably benign Het
Olfr69 A G 7: 103,768,271 (GRCm38) I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 (GRCm38) M33T possibly damaging Het
Patj A T 4: 98,539,073 (GRCm38) I172F unknown Het
Plxna4 A T 6: 32,517,444 (GRCm38) V79D probably damaging Het
Ptprd C G 4: 75,954,078 (GRCm38) A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 (GRCm38) Y469* probably null Het
Rbm33 A G 5: 28,352,586 (GRCm38) T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 (GRCm38) S437L probably damaging Het
Rcor3 A T 1: 192,101,595 (GRCm38) *448R probably null Het
Scn10a T C 9: 119,616,761 (GRCm38) Y1442C probably damaging Het
Scn2a A T 2: 65,717,787 (GRCm38) I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 (GRCm38) I135T probably damaging Het
Sptan1 A T 2: 30,030,712 (GRCm38) M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 (GRCm38) S98P probably benign Het
Tmem106b A T 6: 13,082,431 (GRCm38) T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 (GRCm38) V205A probably benign Het
Tor4a A T 2: 25,194,963 (GRCm38) N309K probably damaging Het
Trbv4 A G 6: 41,059,690 (GRCm38) T50A probably benign Het
Tspyl4 A G 10: 34,297,572 (GRCm38) H20R probably benign Het
Tvp23b T C 11: 62,882,016 (GRCm38) I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 (GRCm38) F273Y probably damaging Het
Vmn2r6 T A 3: 64,559,611 (GRCm38) I156F probably damaging Het
Wnk4 T C 11: 101,274,056 (GRCm38) I737T probably damaging Het
Zfp329 A T 7: 12,811,158 (GRCm38) D146E probably benign Het
Zfp40 A G 17: 23,175,577 (GRCm38) F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 (GRCm38) probably benign Het
Zfp804b T C 5: 6,772,154 (GRCm38) N303S probably benign Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38,982,249 (GRCm38) missense probably damaging 1.00
IGL00509:Fat4 APN 3 38,889,039 (GRCm38) missense probably damaging 1.00
IGL00698:Fat4 APN 3 38,981,145 (GRCm38) missense probably benign 0.17
IGL00934:Fat4 APN 3 38,890,673 (GRCm38) missense probably damaging 1.00
IGL01063:Fat4 APN 3 38,890,579 (GRCm38) missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38,957,269 (GRCm38) missense probably benign 0.00
IGL01313:Fat4 APN 3 39,007,201 (GRCm38) missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38,980,658 (GRCm38) missense probably damaging 1.00
IGL01328:Fat4 APN 3 38,889,991 (GRCm38) missense probably damaging 1.00
IGL01374:Fat4 APN 3 38,887,498 (GRCm38) missense probably damaging 1.00
IGL01412:Fat4 APN 3 38,891,181 (GRCm38) missense probably benign 0.09
IGL01472:Fat4 APN 3 38,888,070 (GRCm38) missense probably damaging 1.00
IGL01514:Fat4 APN 3 38,949,534 (GRCm38) missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39,009,257 (GRCm38) missense probably damaging 1.00
IGL01548:Fat4 APN 3 38,887,758 (GRCm38) missense probably damaging 0.99
IGL01576:Fat4 APN 3 38,888,947 (GRCm38) missense probably damaging 1.00
IGL01591:Fat4 APN 3 39,010,375 (GRCm38) nonsense probably null
IGL01626:Fat4 APN 3 38,951,032 (GRCm38) missense probably damaging 1.00
IGL01746:Fat4 APN 3 38,991,731 (GRCm38) nonsense probably null
IGL01800:Fat4 APN 3 38,981,729 (GRCm38) missense probably damaging 0.99
IGL01815:Fat4 APN 3 38,888,773 (GRCm38) missense probably damaging 1.00
IGL01863:Fat4 APN 3 38,970,619 (GRCm38) splice site probably benign
IGL01917:Fat4 APN 3 38,889,730 (GRCm38) missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38,979,774 (GRCm38) missense probably benign 0.10
IGL02060:Fat4 APN 3 39,010,271 (GRCm38) missense probably damaging 1.00
IGL02103:Fat4 APN 3 38,889,199 (GRCm38) missense probably damaging 0.97
IGL02119:Fat4 APN 3 38,982,939 (GRCm38) missense probably benign 0.10
IGL02124:Fat4 APN 3 38,888,404 (GRCm38) missense probably damaging 1.00
IGL02164:Fat4 APN 3 38,996,205 (GRCm38) critical splice donor site probably null
IGL02182:Fat4 APN 3 38,890,546 (GRCm38) missense probably damaging 1.00
IGL02207:Fat4 APN 3 38,951,263 (GRCm38) missense probably benign 0.16
IGL02210:Fat4 APN 3 38,891,853 (GRCm38) missense probably benign 0.01
IGL02257:Fat4 APN 3 39,001,139 (GRCm38) missense probably benign 0.09
IGL02271:Fat4 APN 3 38,979,919 (GRCm38) missense probably benign 0.18
IGL02305:Fat4 APN 3 39,009,988 (GRCm38) missense probably damaging 1.00
IGL02314:Fat4 APN 3 38,887,630 (GRCm38) missense probably damaging 1.00
IGL02455:Fat4 APN 3 38,951,131 (GRCm38) missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38,983,046 (GRCm38) missense probably benign
IGL02478:Fat4 APN 3 38,888,215 (GRCm38) missense probably damaging 1.00
IGL02480:Fat4 APN 3 39,010,430 (GRCm38) missense probably damaging 1.00
IGL02487:Fat4 APN 3 38,887,245 (GRCm38) missense probably damaging 1.00
IGL02632:Fat4 APN 3 39,002,764 (GRCm38) missense probably benign 0.04
IGL02665:Fat4 APN 3 39,002,836 (GRCm38) missense probably benign 0.08
IGL02674:Fat4 APN 3 38,983,337 (GRCm38) missense probably benign 0.35
IGL02692:Fat4 APN 3 38,951,086 (GRCm38) missense probably damaging 1.00
IGL02710:Fat4 APN 3 38,890,595 (GRCm38) missense probably damaging 1.00
IGL02803:Fat4 APN 3 38,889,295 (GRCm38) missense probably damaging 1.00
IGL02834:Fat4 APN 3 38,956,744 (GRCm38) missense probably damaging 1.00
IGL02891:Fat4 APN 3 38,951,273 (GRCm38) missense probably damaging 1.00
IGL02982:Fat4 APN 3 38,890,843 (GRCm38) missense probably damaging 1.00
IGL02993:Fat4 APN 3 38,957,155 (GRCm38) missense probably damaging 1.00
IGL02996:Fat4 APN 3 38,958,525 (GRCm38) missense probably damaging 1.00
IGL03029:Fat4 APN 3 38,982,591 (GRCm38) missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38,981,552 (GRCm38) missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38,956,859 (GRCm38) missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38,991,685 (GRCm38) missense probably damaging 1.00
IGL03169:Fat4 APN 3 38,957,398 (GRCm38) missense probably benign 0.02
IGL03190:Fat4 APN 3 38,981,241 (GRCm38) missense probably damaging 1.00
IGL03272:Fat4 APN 3 39,009,703 (GRCm38) missense probably benign
IGL03371:Fat4 APN 3 38,983,187 (GRCm38) missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38,889,134 (GRCm38) missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38,957,227 (GRCm38) missense probably damaging 1.00
IGL03394:Fat4 APN 3 38,892,019 (GRCm38) missense probably damaging 0.99
IGL03394:Fat4 APN 3 39,009,364 (GRCm38) missense probably damaging 1.00
IGL03405:Fat4 APN 3 38,958,450 (GRCm38) missense probably benign 0.02
IGL03410:Fat4 APN 3 38,891,176 (GRCm38) missense probably damaging 1.00
Asahi UTSW 3 38,981,819 (GRCm38) missense probably damaging 1.00
Expulsion UTSW 3 38,889,649 (GRCm38) missense probably benign 0.00
heineken UTSW 3 38,980,380 (GRCm38) missense probably damaging 1.00
schlitz UTSW 3 38,980,659 (GRCm38) missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 38,982,357 (GRCm38) missense probably damaging 0.98
PIT4696001:Fat4 UTSW 3 38,889,004 (GRCm38) missense probably benign 0.04
R0015:Fat4 UTSW 3 38,982,503 (GRCm38) missense probably damaging 1.00
R0015:Fat4 UTSW 3 38,982,503 (GRCm38) missense probably damaging 1.00
R0078:Fat4 UTSW 3 38,888,931 (GRCm38) missense probably benign 0.35
R0100:Fat4 UTSW 3 38,980,248 (GRCm38) missense probably damaging 1.00
R0100:Fat4 UTSW 3 38,980,248 (GRCm38) missense probably damaging 1.00
R0201:Fat4 UTSW 3 38,891,596 (GRCm38) missense probably damaging 0.99
R0280:Fat4 UTSW 3 38,890,816 (GRCm38) missense probably benign
R0357:Fat4 UTSW 3 38,891,227 (GRCm38) missense probably damaging 1.00
R0409:Fat4 UTSW 3 38,977,413 (GRCm38) missense probably damaging 1.00
R0498:Fat4 UTSW 3 38,980,637 (GRCm38) missense probably benign 0.00
R0502:Fat4 UTSW 3 39,002,924 (GRCm38) missense probably damaging 0.98
R0506:Fat4 UTSW 3 38,888,314 (GRCm38) missense probably benign 0.00
R0532:Fat4 UTSW 3 38,981,721 (GRCm38) missense probably benign 0.02
R0616:Fat4 UTSW 3 38,942,870 (GRCm38) missense probably damaging 1.00
R0630:Fat4 UTSW 3 39,000,172 (GRCm38) missense probably damaging 1.00
R0678:Fat4 UTSW 3 38,889,694 (GRCm38) missense probably damaging 1.00
R0685:Fat4 UTSW 3 39,001,178 (GRCm38) missense probably benign
R0729:Fat4 UTSW 3 39,000,295 (GRCm38) splice site probably benign
R0748:Fat4 UTSW 3 38,887,828 (GRCm38) missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38,957,474 (GRCm38) missense probably damaging 1.00
R0812:Fat4 UTSW 3 38,957,474 (GRCm38) missense probably damaging 1.00
R0830:Fat4 UTSW 3 38,999,109 (GRCm38) missense probably benign 0.26
R0841:Fat4 UTSW 3 38,995,998 (GRCm38) missense probably damaging 0.99
R0884:Fat4 UTSW 3 38,982,858 (GRCm38) missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38,891,392 (GRCm38) missense probably damaging 1.00
R1066:Fat4 UTSW 3 38,957,227 (GRCm38) missense probably damaging 1.00
R1078:Fat4 UTSW 3 38,983,086 (GRCm38) missense probably benign 0.10
R1084:Fat4 UTSW 3 38,979,825 (GRCm38) missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38,982,942 (GRCm38) missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38,890,371 (GRCm38) missense probably benign 0.01
R1418:Fat4 UTSW 3 38,890,813 (GRCm38) missense probably damaging 1.00
R1475:Fat4 UTSW 3 38,888,323 (GRCm38) missense probably damaging 1.00
R1487:Fat4 UTSW 3 38,995,917 (GRCm38) missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38,983,076 (GRCm38) missense probably damaging 0.97
R1534:Fat4 UTSW 3 38,890,089 (GRCm38) missense probably damaging 1.00
R1558:Fat4 UTSW 3 38,888,986 (GRCm38) missense probably damaging 1.00
R1586:Fat4 UTSW 3 38,888,860 (GRCm38) missense probably damaging 1.00
R1592:Fat4 UTSW 3 39,007,177 (GRCm38) missense probably damaging 0.99
R1655:Fat4 UTSW 3 38,957,318 (GRCm38) missense probably damaging 0.97
R1662:Fat4 UTSW 3 38,980,779 (GRCm38) missense probably damaging 1.00
R1710:Fat4 UTSW 3 38,951,155 (GRCm38) missense probably damaging 1.00
R1731:Fat4 UTSW 3 38,891,310 (GRCm38) missense probably damaging 1.00
R1761:Fat4 UTSW 3 38,887,489 (GRCm38) missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39,010,268 (GRCm38) missense probably damaging 1.00
R1828:Fat4 UTSW 3 38,983,458 (GRCm38) missense probably damaging 1.00
R1835:Fat4 UTSW 3 38,983,571 (GRCm38) missense probably benign 0.00
R1846:Fat4 UTSW 3 38,982,383 (GRCm38) missense probably benign 0.00
R1861:Fat4 UTSW 3 39,010,484 (GRCm38) missense probably benign 0.09
R1871:Fat4 UTSW 3 38,981,072 (GRCm38) missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38,991,664 (GRCm38) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,996,090 (GRCm38) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,887,115 (GRCm38) missense probably benign
R2056:Fat4 UTSW 3 38,891,170 (GRCm38) missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38,891,170 (GRCm38) missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38,891,170 (GRCm38) missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39,010,655 (GRCm38) missense probably benign 0.00
R2078:Fat4 UTSW 3 38,889,673 (GRCm38) missense probably damaging 1.00
R2114:Fat4 UTSW 3 38,981,484 (GRCm38) missense probably benign 0.01
R2135:Fat4 UTSW 3 38,980,733 (GRCm38) missense probably damaging 0.98
R2152:Fat4 UTSW 3 38,983,395 (GRCm38) missense probably damaging 1.00
R2153:Fat4 UTSW 3 38,983,395 (GRCm38) missense probably damaging 1.00
R2154:Fat4 UTSW 3 38,887,539 (GRCm38) missense probably damaging 1.00
R2196:Fat4 UTSW 3 38,981,417 (GRCm38) missense probably benign 0.23
R2211:Fat4 UTSW 3 38,891,527 (GRCm38) missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39,010,215 (GRCm38) missense probably damaging 1.00
R2247:Fat4 UTSW 3 38,892,049 (GRCm38) missense probably damaging 1.00
R2263:Fat4 UTSW 3 38,888,989 (GRCm38) missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38,890,422 (GRCm38) missense probably benign 0.25
R2274:Fat4 UTSW 3 38,995,899 (GRCm38) missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38,980,011 (GRCm38) missense probably damaging 1.00
R2343:Fat4 UTSW 3 38,957,105 (GRCm38) missense probably damaging 0.97
R2365:Fat4 UTSW 3 38,980,419 (GRCm38) missense probably benign
R2412:Fat4 UTSW 3 38,957,072 (GRCm38) missense probably benign 0.05
R2883:Fat4 UTSW 3 38,980,804 (GRCm38) missense probably damaging 1.00
R2942:Fat4 UTSW 3 38,982,336 (GRCm38) missense probably damaging 1.00
R2989:Fat4 UTSW 3 39,007,153 (GRCm38) missense probably benign
R3103:Fat4 UTSW 3 38,891,940 (GRCm38) missense probably benign 0.03
R3158:Fat4 UTSW 3 38,890,791 (GRCm38) missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38,981,274 (GRCm38) missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38,982,438 (GRCm38) missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39,007,261 (GRCm38) missense probably benign 0.10
R3850:Fat4 UTSW 3 39,007,261 (GRCm38) missense probably benign 0.10
R3957:Fat4 UTSW 3 38,982,346 (GRCm38) missense probably benign
R4065:Fat4 UTSW 3 39,009,197 (GRCm38) missense probably benign 0.13
R4078:Fat4 UTSW 3 38,980,020 (GRCm38) missense probably damaging 1.00
R4096:Fat4 UTSW 3 38,887,875 (GRCm38) missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38,942,809 (GRCm38) missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38,891,627 (GRCm38) missense probably damaging 1.00
R4285:Fat4 UTSW 3 38,889,171 (GRCm38) missense probably benign 0.00
R4288:Fat4 UTSW 3 38,891,763 (GRCm38) missense probably damaging 1.00
R4407:Fat4 UTSW 3 38,958,540 (GRCm38) missense probably benign 0.05
R4528:Fat4 UTSW 3 38,891,294 (GRCm38) missense probably benign 0.01
R4547:Fat4 UTSW 3 38,951,283 (GRCm38) missense probably damaging 1.00
R4681:Fat4 UTSW 3 38,887,342 (GRCm38) missense probably damaging 1.00
R4826:Fat4 UTSW 3 38,982,957 (GRCm38) missense probably damaging 1.00
R4855:Fat4 UTSW 3 38,888,317 (GRCm38) missense probably benign
R4871:Fat4 UTSW 3 38,891,605 (GRCm38) missense probably damaging 1.00
R4897:Fat4 UTSW 3 38,980,632 (GRCm38) missense probably damaging 1.00
R4928:Fat4 UTSW 3 39,010,465 (GRCm38) missense probably damaging 1.00
R4932:Fat4 UTSW 3 39,007,203 (GRCm38) missense probably benign 0.00
R4941:Fat4 UTSW 3 38,957,452 (GRCm38) missense probably damaging 1.00
R4943:Fat4 UTSW 3 38,980,173 (GRCm38) missense probably benign 0.19
R4959:Fat4 UTSW 3 38,983,046 (GRCm38) missense probably benign 0.00
R4973:Fat4 UTSW 3 38,983,046 (GRCm38) missense probably benign 0.00
R5098:Fat4 UTSW 3 38,888,289 (GRCm38) missense probably benign 0.34
R5163:Fat4 UTSW 3 38,980,797 (GRCm38) missense probably damaging 1.00
R5213:Fat4 UTSW 3 38,980,191 (GRCm38) missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38,956,868 (GRCm38) missense probably damaging 1.00
R5337:Fat4 UTSW 3 39,010,378 (GRCm38) missense probably benign 0.44
R5337:Fat4 UTSW 3 38,891,627 (GRCm38) missense probably damaging 1.00
R5363:Fat4 UTSW 3 38,888,005 (GRCm38) missense probably damaging 1.00
R5380:Fat4 UTSW 3 38,888,864 (GRCm38) missense probably damaging 1.00
R5384:Fat4 UTSW 3 38,995,946 (GRCm38) missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38,887,245 (GRCm38) missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38,891,346 (GRCm38) missense probably benign 0.00
R5443:Fat4 UTSW 3 39,010,370 (GRCm38) missense probably damaging 1.00
R5501:Fat4 UTSW 3 38,887,215 (GRCm38) missense probably benign 0.09
R5571:Fat4 UTSW 3 39,010,274 (GRCm38) missense probably damaging 1.00
R5625:Fat4 UTSW 3 38,888,934 (GRCm38) missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39,002,968 (GRCm38) missense probably damaging 0.99
R5725:Fat4 UTSW 3 38,889,625 (GRCm38) missense probably damaging 1.00
R5735:Fat4 UTSW 3 38,949,576 (GRCm38) missense probably damaging 1.00
R5739:Fat4 UTSW 3 38,983,134 (GRCm38) missense probably benign 0.01
R5766:Fat4 UTSW 3 38,889,468 (GRCm38) missense probably damaging 1.00
R5780:Fat4 UTSW 3 38,980,955 (GRCm38) missense probably damaging 0.96
R5811:Fat4 UTSW 3 38,891,787 (GRCm38) missense probably damaging 1.00
R5829:Fat4 UTSW 3 39,007,305 (GRCm38) missense probably damaging 1.00
R5879:Fat4 UTSW 3 38,887,336 (GRCm38) missense probably benign
R5933:Fat4 UTSW 3 38,951,375 (GRCm38) critical splice donor site probably null
R5938:Fat4 UTSW 3 38,951,239 (GRCm38) missense probably damaging 1.00
R5940:Fat4 UTSW 3 38,889,649 (GRCm38) missense probably benign 0.00
R5945:Fat4 UTSW 3 38,983,206 (GRCm38) missense probably benign 0.19
R5963:Fat4 UTSW 3 39,010,547 (GRCm38) missense probably damaging 1.00
R6077:Fat4 UTSW 3 39,002,802 (GRCm38) missense probably damaging 1.00
R6158:Fat4 UTSW 3 38,983,262 (GRCm38) missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38,891,721 (GRCm38) missense probably damaging 1.00
R6253:Fat4 UTSW 3 38,951,356 (GRCm38) missense probably damaging 0.99
R6259:Fat4 UTSW 3 39,007,246 (GRCm38) missense probably benign 0.18
R6295:Fat4 UTSW 3 39,007,080 (GRCm38) splice site probably null
R6387:Fat4 UTSW 3 38,983,785 (GRCm38) missense probably damaging 1.00
R6390:Fat4 UTSW 3 38,980,380 (GRCm38) missense probably damaging 1.00
R6456:Fat4 UTSW 3 38,983,979 (GRCm38) missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38,890,887 (GRCm38) missense probably damaging 1.00
R6500:Fat4 UTSW 3 38,981,269 (GRCm38) nonsense probably null
R6503:Fat4 UTSW 3 38,982,257 (GRCm38) missense probably benign 0.00
R6519:Fat4 UTSW 3 39,002,871 (GRCm38) missense probably benign
R6566:Fat4 UTSW 3 38,957,126 (GRCm38) missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38,979,690 (GRCm38) missense probably benign
R6590:Fat4 UTSW 3 38,983,539 (GRCm38) missense probably damaging 1.00
R6658:Fat4 UTSW 3 38,942,928 (GRCm38) missense probably benign 0.01
R6662:Fat4 UTSW 3 38,956,821 (GRCm38) missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38,983,539 (GRCm38) missense probably damaging 1.00
R6807:Fat4 UTSW 3 38,982,440 (GRCm38) missense probably benign 0.18
R6823:Fat4 UTSW 3 38,983,939 (GRCm38) missense probably benign 0.05
R6824:Fat4 UTSW 3 38,957,525 (GRCm38) missense probably benign 0.00
R6830:Fat4 UTSW 3 38,981,817 (GRCm38) missense probably benign 0.00
R6925:Fat4 UTSW 3 38,996,204 (GRCm38) critical splice donor site probably null
R6948:Fat4 UTSW 3 39,009,446 (GRCm38) missense probably damaging 1.00
R6970:Fat4 UTSW 3 38,995,971 (GRCm38) missense probably damaging 1.00
R6970:Fat4 UTSW 3 38,981,775 (GRCm38) missense probably damaging 1.00
R7017:Fat4 UTSW 3 38,891,543 (GRCm38) missense probably benign
R7030:Fat4 UTSW 3 38,981,958 (GRCm38) missense probably damaging 1.00
R7044:Fat4 UTSW 3 39,010,811 (GRCm38) missense probably benign 0.02
R7044:Fat4 UTSW 3 39,010,810 (GRCm38) missense probably benign
R7045:Fat4 UTSW 3 38,888,601 (GRCm38) missense probably benign 0.01
R7094:Fat4 UTSW 3 38,889,874 (GRCm38) missense probably damaging 1.00
R7111:Fat4 UTSW 3 39,010,533 (GRCm38) missense probably damaging 1.00
R7130:Fat4 UTSW 3 38,980,787 (GRCm38) missense probably damaging 0.99
R7168:Fat4 UTSW 3 38,980,659 (GRCm38) missense probably damaging 1.00
R7192:Fat4 UTSW 3 38,980,464 (GRCm38) missense probably benign 0.04
R7194:Fat4 UTSW 3 38,983,895 (GRCm38) missense probably damaging 1.00
R7194:Fat4 UTSW 3 38,888,884 (GRCm38) missense probably damaging 1.00
R7199:Fat4 UTSW 3 38,977,362 (GRCm38) missense probably damaging 0.98
R7213:Fat4 UTSW 3 38,999,087 (GRCm38) missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38,891,043 (GRCm38) missense probably damaging 1.00
R7225:Fat4 UTSW 3 38,980,176 (GRCm38) missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38,890,413 (GRCm38) missense probably benign 0.31
R7239:Fat4 UTSW 3 38,983,840 (GRCm38) missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38,889,693 (GRCm38) missense probably damaging 1.00
R7296:Fat4 UTSW 3 38,889,145 (GRCm38) nonsense probably null
R7372:Fat4 UTSW 3 38,890,209 (GRCm38) missense probably damaging 1.00
R7400:Fat4 UTSW 3 38,887,924 (GRCm38) missense probably damaging 1.00
R7419:Fat4 UTSW 3 39,000,236 (GRCm38) missense probably damaging 1.00
R7430:Fat4 UTSW 3 39,009,644 (GRCm38) missense probably damaging 1.00
R7430:Fat4 UTSW 3 38,887,450 (GRCm38) missense probably damaging 0.97
R7431:Fat4 UTSW 3 39,009,157 (GRCm38) missense possibly damaging 0.80
R7486:Fat4 UTSW 3 38,957,427 (GRCm38) nonsense probably null
R7501:Fat4 UTSW 3 38,958,448 (GRCm38) nonsense probably null
R7533:Fat4 UTSW 3 39,007,257 (GRCm38) missense probably benign 0.43
R7542:Fat4 UTSW 3 38,981,621 (GRCm38) missense possibly damaging 0.64
R7542:Fat4 UTSW 3 38,981,355 (GRCm38) missense possibly damaging 0.56
R7548:Fat4 UTSW 3 38,981,114 (GRCm38) missense probably benign 0.13
R7567:Fat4 UTSW 3 38,889,336 (GRCm38) missense probably damaging 1.00
R7644:Fat4 UTSW 3 39,010,241 (GRCm38) missense possibly damaging 0.64
R7660:Fat4 UTSW 3 38,981,160 (GRCm38) missense probably benign
R7665:Fat4 UTSW 3 38,889,178 (GRCm38) missense probably benign 0.00
R7676:Fat4 UTSW 3 38,891,697 (GRCm38) missense probably damaging 0.98
R7832:Fat4 UTSW 3 39,001,204 (GRCm38) missense probably benign 0.00
R7848:Fat4 UTSW 3 38,887,851 (GRCm38) missense probably benign
R7883:Fat4 UTSW 3 38,981,819 (GRCm38) missense probably damaging 1.00
R7892:Fat4 UTSW 3 38,949,439 (GRCm38) critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38,887,541 (GRCm38) missense probably damaging 1.00
R7952:Fat4 UTSW 3 38,891,721 (GRCm38) missense probably damaging 0.98
R8015:Fat4 UTSW 3 38,981,916 (GRCm38) missense possibly damaging 0.79
R8040:Fat4 UTSW 3 38,981,666 (GRCm38) missense probably damaging 1.00
R8142:Fat4 UTSW 3 38,891,203 (GRCm38) missense probably damaging 1.00
R8151:Fat4 UTSW 3 38,892,054 (GRCm38) missense probably damaging 0.99
R8163:Fat4 UTSW 3 38,979,732 (GRCm38) missense possibly damaging 0.88
R8317:Fat4 UTSW 3 38,958,510 (GRCm38) missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39,008,979 (GRCm38) critical splice acceptor site probably null
R8447:Fat4 UTSW 3 38,979,675 (GRCm38) missense possibly damaging 0.88
R8458:Fat4 UTSW 3 38,981,553 (GRCm38) missense probably benign 0.25
R8509:Fat4 UTSW 3 38,981,903 (GRCm38) missense probably benign
R8543:Fat4 UTSW 3 38,977,494 (GRCm38) missense probably damaging 1.00
R8679:Fat4 UTSW 3 39,010,693 (GRCm38) missense probably damaging 1.00
R8726:Fat4 UTSW 3 39,010,498 (GRCm38) missense probably damaging 1.00
R8743:Fat4 UTSW 3 38,888,443 (GRCm38) missense probably benign 0.16
R8751:Fat4 UTSW 3 38,891,853 (GRCm38) missense probably benign 0.01
R8779:Fat4 UTSW 3 38,979,749 (GRCm38) missense probably damaging 1.00
R8797:Fat4 UTSW 3 38,999,129 (GRCm38) missense probably benign 0.01
R8860:Fat4 UTSW 3 38,892,120 (GRCm38) missense probably benign 0.26
R8955:Fat4 UTSW 3 38,983,629 (GRCm38) missense probably benign 0.01
R9053:Fat4 UTSW 3 38,887,175 (GRCm38) nonsense probably null
R9071:Fat4 UTSW 3 38,983,449 (GRCm38) missense probably benign 0.29
R9088:Fat4 UTSW 3 39,007,299 (GRCm38) missense probably benign 0.02
R9100:Fat4 UTSW 3 39,010,654 (GRCm38) missense
R9180:Fat4 UTSW 3 38,888,407 (GRCm38) missense possibly damaging 0.78
R9184:Fat4 UTSW 3 38,982,443 (GRCm38) missense probably damaging 0.99
R9201:Fat4 UTSW 3 38,890,930 (GRCm38) missense probably damaging 1.00
R9268:Fat4 UTSW 3 38,888,247 (GRCm38) missense probably damaging 1.00
R9278:Fat4 UTSW 3 38,891,022 (GRCm38) missense probably benign 0.44
R9287:Fat4 UTSW 3 38,891,632 (GRCm38) missense probably damaging 0.98
R9355:Fat4 UTSW 3 38,981,898 (GRCm38) missense probably damaging 1.00
R9437:Fat4 UTSW 3 38,891,268 (GRCm38) missense probably benign 0.00
R9455:Fat4 UTSW 3 38,891,263 (GRCm38) missense
R9456:Fat4 UTSW 3 38,888,422 (GRCm38) missense possibly damaging 0.50
R9476:Fat4 UTSW 3 38,983,737 (GRCm38) missense probably benign 0.04
R9510:Fat4 UTSW 3 38,983,737 (GRCm38) missense probably benign 0.04
R9511:Fat4 UTSW 3 38,980,653 (GRCm38) missense probably damaging 0.98
R9540:Fat4 UTSW 3 39,009,197 (GRCm38) missense probably benign
R9568:Fat4 UTSW 3 38,892,007 (GRCm38) missense probably damaging 1.00
R9646:Fat4 UTSW 3 38,981,664 (GRCm38) missense probably damaging 1.00
R9683:Fat4 UTSW 3 38,889,183 (GRCm38) missense possibly damaging 0.52
R9711:Fat4 UTSW 3 39,001,225 (GRCm38) missense probably benign 0.00
X0017:Fat4 UTSW 3 39,009,106 (GRCm38) missense probably benign 0.00
X0019:Fat4 UTSW 3 38,981,040 (GRCm38) missense probably damaging 1.00
X0020:Fat4 UTSW 3 39,000,151 (GRCm38) missense probably damaging 1.00
X0024:Fat4 UTSW 3 38,942,902 (GRCm38) missense probably benign 0.43
X0064:Fat4 UTSW 3 38,970,752 (GRCm38) missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38,958,492 (GRCm38) missense probably benign 0.00
Z1088:Fat4 UTSW 3 38,887,050 (GRCm38) missense possibly damaging 0.88
Z1176:Fat4 UTSW 3 38,983,815 (GRCm38) missense probably damaging 1.00
Z1176:Fat4 UTSW 3 38,983,359 (GRCm38) missense probably benign 0.00
Z1177:Fat4 UTSW 3 38,890,347 (GRCm38) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,888,584 (GRCm38) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,981,838 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTGAAGATCGGCTGTC -3'
(R):5'- TAGAATCAAACTGAGGACCAGC -3'

Sequencing Primer
(F):5'- TCGGGGCCCTAACATCTGTG -3'
(R):5'- TGCCCACAATTGCAGGC -3'
Posted On 2022-02-07