Incidental Mutation 'R9206:Vmn2r6'
ID 698507
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG667069, EG620718
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.241) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64444916-64472855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64467032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect possibly damaging
Transcript: ENSMUST00000165012
AA Change: I67F

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: I67F

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176481
AA Change: I156F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: I156F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,820,330 (GRCm39) D248G probably benign Het
Abcc5 C A 16: 20,208,139 (GRCm39) V605F probably benign Het
Als2 A G 1: 59,224,406 (GRCm39) Y1066H probably damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Apex1 T G 14: 51,163,125 (GRCm39) D69E possibly damaging Het
Atg13 A T 2: 91,512,406 (GRCm39) F288I probably benign Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
Atoh1 A G 6: 64,706,713 (GRCm39) E136G probably benign Het
Ccr7 T C 11: 99,039,895 (GRCm39) N9S probably benign Het
Cdhr1 A C 14: 36,802,505 (GRCm39) W653G probably damaging Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Crnn A C 3: 93,054,251 (GRCm39) I45L possibly damaging Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dnah7a G T 1: 53,540,757 (GRCm39) T2539N probably benign Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fat4 G C 3: 39,063,390 (GRCm39) G4449R probably damaging Het
Fgd5 T C 6: 92,015,191 (GRCm39) L964S probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm973 A T 1: 59,591,585 (GRCm39) Q323L possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Iars2 A T 1: 185,050,146 (GRCm39) M446K possibly damaging Het
Kcnh7 A G 2: 62,607,947 (GRCm39) S545P probably damaging Het
Kif1a G T 1: 92,979,202 (GRCm39) D928E probably damaging Het
Kif26a C T 12: 112,144,480 (GRCm39) T1578M possibly damaging Het
Kif5a A G 10: 127,079,227 (GRCm39) probably null Het
Klhl31 T A 9: 77,558,389 (GRCm39) Y368* probably null Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lamc1 A T 1: 153,126,197 (GRCm39) H498Q probably damaging Het
Ltbp4 A T 7: 27,022,350 (GRCm39) C924S probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nlrp9a C A 7: 26,257,656 (GRCm39) L425M possibly damaging Het
Nop9 T A 14: 55,987,592 (GRCm39) probably null Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Nt5c3 C A 6: 56,874,793 (GRCm39) M1I probably null Het
Or4f61 A G 2: 111,922,410 (GRCm39) F212S probably benign Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rbm27 T A 18: 42,447,163 (GRCm39) Y469* probably null Het
Rbm33 A G 5: 28,557,584 (GRCm39) T266A probably damaging Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Rcor3 A T 1: 191,785,895 (GRCm39) *448R probably null Het
Scn10a T C 9: 119,445,827 (GRCm39) Y1442C probably damaging Het
Scn2a A T 2: 65,548,131 (GRCm39) I1108F probably damaging Het
Scrn2 T C 11: 96,922,962 (GRCm39) I135T probably damaging Het
Sptan1 A T 2: 29,920,724 (GRCm39) M2380L possibly damaging Het
Tbc1d12 T C 19: 38,825,442 (GRCm39) S98P probably benign Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Tor4a A T 2: 25,084,975 (GRCm39) N309K probably damaging Het
Trbv4 A G 6: 41,036,624 (GRCm39) T50A probably benign Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Tvp23b T C 11: 62,772,842 (GRCm39) I31T possibly damaging Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Wnk4 T C 11: 101,164,882 (GRCm39) I737T probably damaging Het
Zfp329 A T 7: 12,545,085 (GRCm39) D146E probably benign Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp804b T C 5: 6,822,154 (GRCm39) N303S probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64,445,525 (GRCm39) missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64,463,766 (GRCm39) missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64,445,323 (GRCm39) missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64,463,610 (GRCm39) missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64,463,749 (GRCm39) missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64,463,911 (GRCm39) missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64,463,917 (GRCm39) missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64,472,574 (GRCm39) missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64,445,428 (GRCm39) missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64,466,966 (GRCm39) nonsense probably null
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0208:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0427:Vmn2r6 UTSW 3 64,467,008 (GRCm39) missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64,463,723 (GRCm39) missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64,464,261 (GRCm39) missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64,445,487 (GRCm39) missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64,472,488 (GRCm39) missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64,445,694 (GRCm39) missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64,445,579 (GRCm39) nonsense probably null
R1498:Vmn2r6 UTSW 3 64,463,890 (GRCm39) missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64,463,698 (GRCm39) missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64,445,262 (GRCm39) missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64,463,519 (GRCm39) missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64,467,139 (GRCm39) missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64,464,090 (GRCm39) missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64,464,090 (GRCm39) missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64,463,773 (GRCm39) missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64,445,707 (GRCm39) missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64,463,929 (GRCm39) missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64,464,042 (GRCm39) missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64,463,893 (GRCm39) missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64,445,369 (GRCm39) missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64,445,145 (GRCm39) missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64,467,068 (GRCm39) missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64,454,829 (GRCm39) missense probably benign
R4934:Vmn2r6 UTSW 3 64,463,766 (GRCm39) missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64,445,207 (GRCm39) missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64,445,044 (GRCm39) missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64,464,015 (GRCm39) missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64,445,935 (GRCm39) missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64,445,411 (GRCm39) missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64,464,263 (GRCm39) missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64,463,454 (GRCm39) missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64,472,652 (GRCm39) missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64,463,953 (GRCm39) missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64,467,176 (GRCm39) missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64,445,424 (GRCm39) missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64,464,226 (GRCm39) missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64,454,801 (GRCm39) nonsense probably null
R6645:Vmn2r6 UTSW 3 64,464,297 (GRCm39) missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64,445,580 (GRCm39) missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64,464,195 (GRCm39) missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64,447,372 (GRCm39) nonsense probably null
R7562:Vmn2r6 UTSW 3 64,463,941 (GRCm39) missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64,472,683 (GRCm39) missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64,472,563 (GRCm39) missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64,463,991 (GRCm39) missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64,445,443 (GRCm39) missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64,467,241 (GRCm39) missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64,467,245 (GRCm39) missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64,455,064 (GRCm39) intron probably benign
R8169:Vmn2r6 UTSW 3 64,447,310 (GRCm39) missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64,463,526 (GRCm39) nonsense probably null
R8736:Vmn2r6 UTSW 3 64,467,221 (GRCm39) missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64,463,576 (GRCm39) missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64,464,277 (GRCm39) missense probably benign 0.12
R9295:Vmn2r6 UTSW 3 64,463,484 (GRCm39) missense probably benign 0.00
R9332:Vmn2r6 UTSW 3 64,454,671 (GRCm39) missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64,445,724 (GRCm39) missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64,463,549 (GRCm39) missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64,464,081 (GRCm39) missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64,445,871 (GRCm39) missense probably benign
X0066:Vmn2r6 UTSW 3 64,454,799 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64,463,746 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGCAGCATCTCTATACCTCATAG -3'
(R):5'- TCCGCTGGATGAAAACCATG -3'

Sequencing Primer
(F):5'- TGAGTGCATAGAGATTCACCTGCC -3'
(R):5'- GCTGGATGAAAACCATGATCCAC -3'
Posted On 2022-02-07