Incidental Mutation 'R9206:Vmn2r6'
ID 698507
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG620718, EG667069
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64537561-64565298 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64559611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect possibly damaging
Transcript: ENSMUST00000165012
AA Change: I67F

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: I67F

Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176481
AA Change: I156F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: I156F

signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 D248G probably benign Het
Abcc5 C A 16: 20,389,389 V605F probably benign Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Als2 A G 1: 59,185,247 Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Apex1 T G 14: 50,925,668 D69E possibly damaging Het
Atg13 A T 2: 91,682,061 F288I probably benign Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
Atoh1 A G 6: 64,729,729 E136G probably benign Het
Ccr7 T C 11: 99,149,069 N9S probably benign Het
Cdhr1 A C 14: 37,080,548 W653G probably damaging Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Crnn A C 3: 93,146,944 I45L possibly damaging Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dnah7a G T 1: 53,501,598 T2539N probably benign Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fat4 G C 3: 39,009,241 G4449R probably damaging Het
Fgd5 T C 6: 92,038,210 L964S probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm973 A T 1: 59,552,426 Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Iars2 A T 1: 185,317,949 M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 S545P probably damaging Het
Kif1a G T 1: 93,051,480 D928E probably damaging Het
Kif26a C T 12: 112,178,046 T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 probably null Het
Klhl31 T A 9: 77,651,107 Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 C924S probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nlrp9a C A 7: 26,558,231 L425M possibly damaging Het
Nop9 T A 14: 55,750,135 probably null Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Nt5c3 C A 6: 56,897,808 M1I probably null Het
Olfr1314 A G 2: 112,092,065 F212S probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 Y469* probably null Het
Rbm33 A G 5: 28,352,586 T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rcor3 A T 1: 192,101,595 *448R probably null Het
Scn10a T C 9: 119,616,761 Y1442C probably damaging Het
Scn2a A T 2: 65,717,787 I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 I135T probably damaging Het
Sptan1 A T 2: 30,030,712 M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 S98P probably benign Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Tor4a A T 2: 25,194,963 N309K probably damaging Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Tvp23b T C 11: 62,882,016 I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Wnk4 T C 11: 101,274,056 I737T probably damaging Het
Zfp329 A T 7: 12,811,158 D146E probably benign Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp804b T C 5: 6,772,154 N303S probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64559820 missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64556105 nonsense probably null
R8736:Vmn2r6 UTSW 3 64559800 missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64556155 missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64556856 missense probably benign 0.12
R9295:Vmn2r6 UTSW 3 64556063 missense probably benign 0.00
R9332:Vmn2r6 UTSW 3 64547250 missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64538303 missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64556128 missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64556660 missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2022-02-07