Incidental Mutation 'R9206:Crnn'
ID 698508
Institutional Source Beutler Lab
Gene Symbol Crnn
Ensembl Gene ENSMUSG00000078657
Gene Name cornulin
Synonyms LOC381457
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 93052096-93057125 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 93054251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 45 (I45L)
Ref Sequence ENSEMBL: ENSMUSP00000102921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107300] [ENSMUST00000195515]
AlphaFold D3YUU6
Predicted Effect possibly damaging
Transcript: ENSMUST00000107300
AA Change: I45L

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102921
Gene: ENSMUSG00000078657
AA Change: I45L

DomainStartEndE-ValueType
Pfam:S_100 4 45 1.9e-12 PFAM
Blast:EFh 53 81 1e-10 BLAST
low complexity region 181 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192372
Predicted Effect possibly damaging
Transcript: ENSMUST00000195515
AA Change: I45L

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141980
Gene: ENSMUSG00000078657
AA Change: I45L

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-10 PFAM
Blast:EFh 53 81 1e-10 BLAST
low complexity region 181 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the "fused gene" family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,820,330 (GRCm39) D248G probably benign Het
Abcc5 C A 16: 20,208,139 (GRCm39) V605F probably benign Het
Als2 A G 1: 59,224,406 (GRCm39) Y1066H probably damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Apex1 T G 14: 51,163,125 (GRCm39) D69E possibly damaging Het
Atg13 A T 2: 91,512,406 (GRCm39) F288I probably benign Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
Atoh1 A G 6: 64,706,713 (GRCm39) E136G probably benign Het
Ccr7 T C 11: 99,039,895 (GRCm39) N9S probably benign Het
Cdhr1 A C 14: 36,802,505 (GRCm39) W653G probably damaging Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dnah7a G T 1: 53,540,757 (GRCm39) T2539N probably benign Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fat4 G C 3: 39,063,390 (GRCm39) G4449R probably damaging Het
Fgd5 T C 6: 92,015,191 (GRCm39) L964S probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm973 A T 1: 59,591,585 (GRCm39) Q323L possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Iars2 A T 1: 185,050,146 (GRCm39) M446K possibly damaging Het
Kcnh7 A G 2: 62,607,947 (GRCm39) S545P probably damaging Het
Kif1a G T 1: 92,979,202 (GRCm39) D928E probably damaging Het
Kif26a C T 12: 112,144,480 (GRCm39) T1578M possibly damaging Het
Kif5a A G 10: 127,079,227 (GRCm39) probably null Het
Klhl31 T A 9: 77,558,389 (GRCm39) Y368* probably null Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lamc1 A T 1: 153,126,197 (GRCm39) H498Q probably damaging Het
Ltbp4 A T 7: 27,022,350 (GRCm39) C924S probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nlrp9a C A 7: 26,257,656 (GRCm39) L425M possibly damaging Het
Nop9 T A 14: 55,987,592 (GRCm39) probably null Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Nt5c3 C A 6: 56,874,793 (GRCm39) M1I probably null Het
Or4f61 A G 2: 111,922,410 (GRCm39) F212S probably benign Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rbm27 T A 18: 42,447,163 (GRCm39) Y469* probably null Het
Rbm33 A G 5: 28,557,584 (GRCm39) T266A probably damaging Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Rcor3 A T 1: 191,785,895 (GRCm39) *448R probably null Het
Scn10a T C 9: 119,445,827 (GRCm39) Y1442C probably damaging Het
Scn2a A T 2: 65,548,131 (GRCm39) I1108F probably damaging Het
Scrn2 T C 11: 96,922,962 (GRCm39) I135T probably damaging Het
Sptan1 A T 2: 29,920,724 (GRCm39) M2380L possibly damaging Het
Tbc1d12 T C 19: 38,825,442 (GRCm39) S98P probably benign Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Tor4a A T 2: 25,084,975 (GRCm39) N309K probably damaging Het
Trbv4 A G 6: 41,036,624 (GRCm39) T50A probably benign Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Tvp23b T C 11: 62,772,842 (GRCm39) I31T possibly damaging Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Vmn2r6 T A 3: 64,467,032 (GRCm39) I156F probably damaging Het
Wnk4 T C 11: 101,164,882 (GRCm39) I737T probably damaging Het
Zfp329 A T 7: 12,545,085 (GRCm39) D146E probably benign Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp804b T C 5: 6,822,154 (GRCm39) N303S probably benign Het
Other mutations in Crnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Crnn APN 3 93,055,519 (GRCm39) missense probably damaging 1.00
IGL01343:Crnn APN 3 93,055,633 (GRCm39) missense probably benign 0.01
IGL02393:Crnn APN 3 93,056,675 (GRCm39) missense probably damaging 0.99
IGL03220:Crnn APN 3 93,056,674 (GRCm39) missense possibly damaging 0.49
IGL03275:Crnn APN 3 93,056,725 (GRCm39) missense possibly damaging 0.57
R1698:Crnn UTSW 3 93,055,765 (GRCm39) missense probably damaging 0.97
R1745:Crnn UTSW 3 93,054,198 (GRCm39) missense probably benign 0.33
R1761:Crnn UTSW 3 93,055,958 (GRCm39) missense probably benign
R1974:Crnn UTSW 3 93,056,594 (GRCm39) missense probably benign 0.01
R2109:Crnn UTSW 3 93,055,747 (GRCm39) missense probably benign 0.43
R4179:Crnn UTSW 3 93,054,120 (GRCm39) start codon destroyed probably null 1.00
R4976:Crnn UTSW 3 93,055,990 (GRCm39) missense probably benign 0.12
R5120:Crnn UTSW 3 93,056,203 (GRCm39) missense probably benign 0.03
R5425:Crnn UTSW 3 93,056,456 (GRCm39) missense probably benign
R5695:Crnn UTSW 3 93,056,330 (GRCm39) missense probably damaging 0.98
R6596:Crnn UTSW 3 93,054,182 (GRCm39) missense probably damaging 1.00
R6981:Crnn UTSW 3 93,055,442 (GRCm39) missense probably damaging 1.00
R7145:Crnn UTSW 3 93,055,689 (GRCm39) missense probably damaging 1.00
R7170:Crnn UTSW 3 93,056,020 (GRCm39) missense possibly damaging 0.85
R7365:Crnn UTSW 3 93,055,841 (GRCm39) missense probably damaging 0.97
R7375:Crnn UTSW 3 93,056,452 (GRCm39) missense possibly damaging 0.87
R7511:Crnn UTSW 3 93,056,723 (GRCm39) missense probably damaging 1.00
R8669:Crnn UTSW 3 93,056,296 (GRCm39) nonsense probably null
R8868:Crnn UTSW 3 93,055,609 (GRCm39) missense probably benign 0.00
Z1177:Crnn UTSW 3 93,056,603 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTATGGTGCCCATAAAAGG -3'
(R):5'- GATCCAAGAAGCTGCCCTTTC -3'

Sequencing Primer
(F):5'- GGCCTTTTTATATTTTCCAGCATAGC -3'
(R):5'- CTATAAGGAGCTGGATCTGTCACC -3'
Posted On 2022-02-07