Mutagenetix > Incidental Mutation

Incidental Mutation 'R9206:Ptprd'

698511

Institutional Source

Beutler Lab

Gene Symbol

Ptprd

Ensembl Gene

ENSMUSG00000028399

Gene Name

protein tyrosine phosphatase, receptor type, D

Synonyms

1110002J03Rik, 3000002J10Rik, B230219D21Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9206 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75941238-78211961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 75954078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Proline at position 1134 (A1134P)

Ref Sequence

ENSEMBL: ENSMUSP00000099898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831]

AlphaFold

Q64487

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050757
AA Change: A1385P

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: A1385P

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
IGc2	238	299	8.13e-4	SMART
FN3	313	392	7.92e-14	SMART
FN3	408	491	5.73e-11	SMART
IG_like	499	593	8.34e1	SMART
FN3	506	584	9.1e-14	SMART
FN3	597	674	1.21e0	SMART
transmembrane domain	847	869	N/A	INTRINSIC
low complexity region	870	882	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098005
AA Change: A1386P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: A1386P

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	857	879	N/A	INTRINSIC
low complexity region	886	897	N/A	INTRINSIC
PTPc	950	1208	6.38e-134	SMART
PTPc	1237	1499	9.17e-135	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102834
AA Change: A1134P

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: A1134P

Domain	Start	End	E-Value	Type
IGc2	1	62	8.13e-4	SMART
FN3	76	155	7.92e-14	SMART
FN3	171	254	5.73e-11	SMART
IG_like	262	356	8.34e1	SMART
FN3	269	347	9.1e-14	SMART
FN3	360	437	1.21e0	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	633	645	N/A	INTRINSIC
PTPc	698	956	6.38e-134	SMART
PTPc	985	1247	9.17e-135	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107289
AA Change: A1792P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: A1792P

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	609	696	2.72e-12	SMART
FN3	712	809	2.87e-11	SMART
FN3	824	904	4.96e-6	SMART
FN3	919	1003	4.12e-12	SMART
FN3	1018	1095	1.95e0	SMART
transmembrane domain	1268	1290	N/A	INTRINSIC
low complexity region	1291	1303	N/A	INTRINSIC
PTPc	1356	1614	6.38e-134	SMART
PTPc	1643	1905	9.17e-135	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173376
AA Change: A1388P

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: A1388P

Domain	Start	End	E-Value	Type
IGc2	43	112	8.57e-12	SMART
IGc2	145	221	8.5e-16	SMART
low complexity region	232	244	N/A	INTRINSIC
IGc2	255	316	8.13e-4	SMART
FN3	330	409	7.92e-14	SMART
FN3	425	508	5.73e-11	SMART
IG_like	516	610	8.34e1	SMART
FN3	523	601	9.1e-14	SMART
FN3	614	691	1.21e0	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	887	899	N/A	INTRINSIC
PTPc	952	1210	6.38e-134	SMART
PTPc	1239	1501	9.17e-135	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174023
AA Change: A1382P

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: A1382P

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	211	4.88e-16	SMART
low complexity region	222	234	N/A	INTRINSIC
IGc2	245	306	8.13e-4	SMART
FN3	320	399	7.92e-14	SMART
FN3	415	498	5.73e-11	SMART
IG_like	506	600	8.34e1	SMART
FN3	513	591	9.1e-14	SMART
FN3	604	681	1.21e0	SMART
transmembrane domain	853	875	N/A	INTRINSIC
low complexity region	882	893	N/A	INTRINSIC
PTPc	946	1204	6.38e-134	SMART
PTPc	1233	1495	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174180
AA Change: A1770P

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: A1770P

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	205	2.09e-15	SMART
IGc2	235	296	8.13e-4	SMART
FN3	310	389	7.92e-14	SMART
FN3	405	488	5.73e-11	SMART
IG_like	496	590	8.34e1	SMART
FN3	503	581	9.1e-14	SMART
FN3	596	683	2.72e-12	SMART
FN3	699	787	6.15e-11	SMART
FN3	802	882	4.96e-6	SMART
FN3	897	981	4.12e-12	SMART
FN3	996	1073	1.95e0	SMART
transmembrane domain	1246	1268	N/A	INTRINSIC
low complexity region	1269	1281	N/A	INTRINSIC
PTPc	1334	1592	6.38e-134	SMART
PTPc	1621	1883	9.17e-135	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174531
AA Change: A1375P

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: A1375P

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
low complexity region	219	231	N/A	INTRINSIC
IGc2	242	303	8.13e-4	SMART
FN3	317	396	7.92e-14	SMART
FN3	412	495	5.73e-11	SMART
IG_like	503	597	8.34e1	SMART
FN3	510	588	9.1e-14	SMART
FN3	601	678	1.21e0	SMART
transmembrane domain	851	873	N/A	INTRINSIC
low complexity region	874	886	N/A	INTRINSIC
PTPc	939	1197	6.38e-134	SMART
PTPc	1226	1488	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174831
AA Change: A1385P

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: A1385P

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Meta Mutation Damage Score

0.1564

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	G	17: 45,509,404	D248G	probably benign	Het
Abcc5	C	A	16: 20,389,389	V605F	probably benign	Het
AI314180	A	T	4: 58,875,444	D173E	probably damaging	Het
Als2	A	G	1: 59,185,247	Y1066H	probably damaging	Het
Apbb1	A	G	7: 105,559,520	S569P	probably damaging	Het
Apex1	T	G	14: 50,925,668	D69E	possibly damaging	Het
Atg13	A	T	2: 91,682,061	F288I	probably benign	Het
Atl3	A	G	19: 7,510,082	I121V	probably benign	Het
Atoh1	A	G	6: 64,729,729	E136G	probably benign	Het
Ccr7	T	C	11: 99,149,069	N9S	probably benign	Het
Cdhr1	A	C	14: 37,080,548	W653G	probably damaging	Het
Cln6	T	A	9: 62,849,183	M203K	probably benign	Het
Crnn	A	C	3: 93,146,944	I45L	possibly damaging	Het
Cse1l	C	A	2: 166,941,265	N743K	probably damaging	Het
Cyp1a2	A	G	9: 57,682,300	I77T	probably damaging	Het
D6Wsu163e	A	G	6: 126,966,969	I443V	probably benign	Het
Dnah7a	G	T	1: 53,501,598	T2539N	probably benign	Het
Fam13c	A	G	10: 70,553,039	E465G	probably damaging	Het
Fat4	G	C	3: 39,009,241	G4449R	probably damaging	Het
Fgd5	T	C	6: 92,038,210	L964S	probably damaging	Het
Fpr3	A	T	17: 17,970,869	Q134L	probably damaging	Het
Gm973	A	T	1: 59,552,426	Q323L	possibly damaging	Het
Gna15	A	G	10: 81,509,390	S214P	probably benign	Het
Iars2	A	T	1: 185,317,949	M446K	possibly damaging	Het
Kcnh7	A	G	2: 62,777,603	S545P	probably damaging	Het
Kif1a	G	T	1: 93,051,480	D928E	probably damaging	Het
Kif26a	C	T	12: 112,178,046	T1578M	possibly damaging	Het
Kif5a	A	G	10: 127,243,358		probably null	Het
Klhl31	T	A	9: 77,651,107	Y368*	probably null	Het
Krtap27-1	A	G	16: 88,671,428	V76A	possibly damaging	Het
Lamc1	A	T	1: 153,250,451	H498Q	probably damaging	Het
Ltbp4	A	T	7: 27,322,925	C924S	probably damaging	Het
Ltn1	T	C	16: 87,400,410	D1180G	probably benign	Het
Macf1	A	G	4: 123,684,132	C20R	unknown	Het
Mpp7	T	C	18: 7,403,327	R328G	probably benign	Het
Ncdn	A	T	4: 126,750,248	D260E	probably benign	Het
Nlrp9a	C	A	7: 26,558,231	L425M	possibly damaging	Het
Nop9	T	A	14: 55,750,135		probably null	Het
Nrip1	T	C	16: 76,292,728	E647G	possibly damaging	Het
Nt5c3	C	A	6: 56,897,808	M1I	probably null	Het
Olfr1314	A	G	2: 112,092,065	F212S	probably benign	Het
Olfr69	A	G	7: 103,768,271	I42T	probably benign	Het
Olfr892-ps1	T	C	9: 38,189,824	M33T	possibly damaging	Het
Patj	A	T	4: 98,539,073	I172F	unknown	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Rbm27	T	A	18: 42,314,098	Y469*	probably null	Het
Rbm33	A	G	5: 28,352,586	T266A	probably damaging	Het
Rcbtb2	C	T	14: 73,177,060	S437L	probably damaging	Het
Rcor3	A	T	1: 192,101,595	*448R	probably null	Het
Scn10a	T	C	9: 119,616,761	Y1442C	probably damaging	Het
Scn2a	A	T	2: 65,717,787	I1108F	probably damaging	Het
Scrn2	T	C	11: 97,032,136	I135T	probably damaging	Het
Sptan1	A	T	2: 30,030,712	M2380L	possibly damaging	Het
Tbc1d12	T	C	19: 38,836,998	S98P	probably benign	Het
Tmem106b	A	T	6: 13,082,431	T202S	probably damaging	Het
Tnfsf8	A	G	4: 63,834,213	V205A	probably benign	Het
Tor4a	A	T	2: 25,194,963	N309K	probably damaging	Het
Trbv4	A	G	6: 41,059,690	T50A	probably benign	Het
Tspyl4	A	G	10: 34,297,572	H20R	probably benign	Het
Tvp23b	T	C	11: 62,882,016	I31T	possibly damaging	Het
Vmn1r192	A	T	13: 22,187,231	F273Y	probably damaging	Het
Vmn2r6	T	A	3: 64,559,611	I156F	probably damaging	Het
Wnk4	T	C	11: 101,274,056	I737T	probably damaging	Het
Zfp329	A	T	7: 12,811,158	D146E	probably benign	Het
Zfp40	A	G	17: 23,175,577	F679L	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp804b	T	C	5: 6,772,154	N303S	probably benign	Het

Other mutations in Ptprd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Ptprd	APN	4	75998556	nonsense	probably null
IGL01067:Ptprd	APN	4	76059685	missense	probably damaging	1.00
IGL01121:Ptprd	APN	4	75954201	splice site	probably benign
IGL01531:Ptprd	APN	4	76085520	missense	probably damaging	0.98
IGL01661:Ptprd	APN	4	75954083	missense	probably damaging	1.00
IGL01723:Ptprd	APN	4	76243673	missense	probably damaging	1.00
IGL01735:Ptprd	APN	4	76136820	splice site	probably null
IGL01810:Ptprd	APN	4	76140507	splice site	probably benign
IGL01834:Ptprd	APN	4	76128595	missense	probably damaging	1.00
IGL01835:Ptprd	APN	4	76246821	missense	probably benign	0.02
IGL01867:Ptprd	APN	4	76243647	missense	probably damaging	1.00
IGL02582:Ptprd	APN	4	75947124	missense	probably damaging	1.00
IGL02591:Ptprd	APN	4	75982050	missense	probably damaging	1.00
IGL02741:Ptprd	APN	4	76133284	missense	probably damaging	1.00
IGL02866:Ptprd	APN	4	76050437	missense	probably damaging	1.00
IGL02960:Ptprd	APN	4	76128868	missense	probably damaging	1.00
IGL03155:Ptprd	APN	4	76066219	missense	possibly damaging	0.95
IGL03230:Ptprd	APN	4	76050417	nonsense	probably null
IGL03343:Ptprd	APN	4	76059729	missense	probably damaging	1.00
unhurried	UTSW	4	76100633	nonsense	probably null
ANU22:Ptprd	UTSW	4	76100456	missense	probably damaging	0.99
F5493:Ptprd	UTSW	4	76084408	missense	probably damaging	1.00
P0033:Ptprd	UTSW	4	76128854	nonsense	probably null
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0076:Ptprd	UTSW	4	75947039	splice site	probably benign
R0137:Ptprd	UTSW	4	76136903	missense	probably benign	0.24
R0358:Ptprd	UTSW	4	75944989	missense	probably damaging	1.00
R0365:Ptprd	UTSW	4	76136846	missense	probably damaging	1.00
R0385:Ptprd	UTSW	4	76128665	missense	probably damaging	1.00
R0601:Ptprd	UTSW	4	76100474	missense	probably benign
R0646:Ptprd	UTSW	4	76084403	missense	probably damaging	0.99
R0667:Ptprd	UTSW	4	75957346	missense	probably damaging	1.00
R0707:Ptprd	UTSW	4	75957239	missense	probably damaging	1.00
R0734:Ptprd	UTSW	4	76140597	missense	probably damaging	1.00
R0827:Ptprd	UTSW	4	76128915	missense	probably damaging	0.98
R0932:Ptprd	UTSW	4	76136885	missense	probably damaging	1.00
R1069:Ptprd	UTSW	4	75998487	splice site	probably benign
R1069:Ptprd	UTSW	4	76100633	nonsense	probably null
R1086:Ptprd	UTSW	4	76133258	missense	probably damaging	1.00
R1439:Ptprd	UTSW	4	76066200	missense	probably damaging	1.00
R1440:Ptprd	UTSW	4	76084552	missense	probably damaging	0.98
R1688:Ptprd	UTSW	4	75982684	missense	probably damaging	1.00
R1858:Ptprd	UTSW	4	75947147	missense	probably damaging	1.00
R2001:Ptprd	UTSW	4	75954122	missense	probably damaging	1.00
R2020:Ptprd	UTSW	4	76133161	missense	probably damaging	1.00
R2023:Ptprd	UTSW	4	75957104	missense	probably damaging	1.00
R2413:Ptprd	UTSW	4	76133200	missense	probably damaging	1.00
R2510:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R2914:Ptprd	UTSW	4	75947101	missense	probably damaging	1.00
R2971:Ptprd	UTSW	4	76107324	missense	probably benign	0.10
R3051:Ptprd	UTSW	4	76100630	missense	probably damaging	1.00
R3433:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R3964:Ptprd	UTSW	4	76059836	splice site	probably benign
R4009:Ptprd	UTSW	4	75956397	missense	possibly damaging	0.94
R4394:Ptprd	UTSW	4	76128685	missense	probably damaging	1.00
R4420:Ptprd	UTSW	4	76039377	missense	possibly damaging	0.92
R4424:Ptprd	UTSW	4	76102963	missense	probably benign	0.22
R4575:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4578:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4715:Ptprd	UTSW	4	76107333	missense	probably benign	0.03
R4782:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4785:Ptprd	UTSW	4	76140553	missense	probably benign	0.05
R4799:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4944:Ptprd	UTSW	4	76128899	missense	probably damaging	1.00
R4950:Ptprd	UTSW	4	76140515	splice site	probably null
R4969:Ptprd	UTSW	4	76133305	missense	probably damaging	1.00
R5153:Ptprd	UTSW	4	76012102	missense	probably damaging	1.00
R5164:Ptprd	UTSW	4	76100758	splice site	probably null
R5287:Ptprd	UTSW	4	75954168	nonsense	probably null
R5305:Ptprd	UTSW	4	75982626	missense	probably damaging	1.00
R5362:Ptprd	UTSW	4	76128813	missense	probably damaging	1.00
R5403:Ptprd	UTSW	4	75954168	nonsense	probably null
R5531:Ptprd	UTSW	4	76059667	critical splice donor site	probably null
R5543:Ptprd	UTSW	4	76059753	missense	probably damaging	1.00
R5634:Ptprd	UTSW	4	76072018	missense	probably benign	0.01
R5719:Ptprd	UTSW	4	76054602	critical splice acceptor site	probably null
R5884:Ptprd	UTSW	4	75982690	missense	probably damaging	1.00
R6247:Ptprd	UTSW	4	76066291	missense	probably benign	0.06
R6250:Ptprd	UTSW	4	76128995	missense	probably damaging	1.00
R6335:Ptprd	UTSW	4	75954183	missense	probably damaging	1.00
R6352:Ptprd	UTSW	4	76091552	splice site	probably null
R6533:Ptprd	UTSW	4	76128528	missense	probably damaging	1.00
R6756:Ptprd	UTSW	4	75955299	missense	probably damaging	1.00
R6782:Ptprd	UTSW	4	76325140	splice site	probably null
R7131:Ptprd	UTSW	4	76066340	missense	probably damaging	1.00
R7170:Ptprd	UTSW	4	76071962	missense	probably benign	0.06
R7233:Ptprd	UTSW	4	76059783	missense	probably benign	0.00
R7246:Ptprd	UTSW	4	76128676	missense	probably damaging	1.00
R7413:Ptprd	UTSW	4	76246839	missense	probably benign	0.00
R7428:Ptprd	UTSW	4	76086468	missense	probably benign	0.03
R7442:Ptprd	UTSW	4	76059821	nonsense	probably null
R7491:Ptprd	UTSW	4	76133155	missense	probably benign	0.23
R7526:Ptprd	UTSW	4	76066327	missense	probably benign	0.00
R7609:Ptprd	UTSW	4	76072003	missense	probably benign	0.03
R7612:Ptprd	UTSW	4	76086459	missense	probably benign	0.45
R7659:Ptprd	UTSW	4	76128916	missense	probably benign	0.03
R7743:Ptprd	UTSW	4	76086089	missense	probably damaging	1.00
R7748:Ptprd	UTSW	4	76099504	missense	probably null	0.39
R7788:Ptprd	UTSW	4	75998604	missense	probably damaging	1.00
R7836:Ptprd	UTSW	4	75982644	missense	probably damaging	0.99
R7937:Ptprd	UTSW	4	76095535	missense	probably benign	0.00
R8000:Ptprd	UTSW	4	76066242	missense	possibly damaging	0.95
R8018:Ptprd	UTSW	4	76085520	missense	probably damaging	0.98
R8072:Ptprd	UTSW	4	76086036	missense	probably benign	0.01
R8119:Ptprd	UTSW	4	76129026	missense	probably benign	0.00
R8350:Ptprd	UTSW	4	75950661	missense	probably damaging	1.00
R8387:Ptprd	UTSW	4	75955289	missense	probably damaging	1.00
R8458:Ptprd	UTSW	4	76066259	missense	probably benign	0.00
R8529:Ptprd	UTSW	4	76129025	missense	probably damaging	1.00
R8699:Ptprd	UTSW	4	76041392	missense	probably benign
R8924:Ptprd	UTSW	4	75998499	critical splice donor site	probably null
R8984:Ptprd	UTSW	4	75945014	missense	probably damaging	1.00
R9024:Ptprd	UTSW	4	75956330	missense	probably damaging	1.00
R9204:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9259:Ptprd	UTSW	4	76071963	missense	probably damaging	0.99
R9311:Ptprd	UTSW	4	76133083	missense	probably benign	0.25
R9417:Ptprd	UTSW	4	75947098	missense	probably damaging	0.99
R9427:Ptprd	UTSW	4	76133203	missense	probably benign	0.01
R9579:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9580:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9701:Ptprd	UTSW	4	75998659	missense	probably damaging	1.00
RF016:Ptprd	UTSW	4	76128655	missense	probably benign	0.01
RF023:Ptprd	UTSW	4	76128565	missense	probably damaging	0.98
Z1176:Ptprd	UTSW	4	76133214	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCCTGGGCTTATGTAAATACTTCC -3'
(R):5'- ACACCAGATAGTTTGCCTGTC -3'

Sequencing Primer
(F):5'- TGTAAATACTTCCCAGATAAAGGGG -3'
(R):5'- ACACCAGATAGTTTGCCTGTCTTTAG -3'

Posted On

2022-02-07