Mutagenetix > Incidental Mutation

Incidental Mutation 'R9206:Zfp804b'

698515

Institutional Source

Beutler Lab

Gene Symbol

Zfp804b

Ensembl Gene

ENSMUSG00000092094

Gene Name

zinc finger protein 804B

Synonyms

LOC207618

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R9206 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

6769010-7344756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6772154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 303 (N303S)

Ref Sequence

ENSEMBL: ENSMUSP00000143568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]

AlphaFold

A0A0G2JGH6

Predicted Effect

probably benign
Transcript: ENSMUST00000164784
AA Change: N267S

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: N267S

Domain	Start	End	E-Value	Type
ZnF_C2H2	20	44	4.81e0	SMART
low complexity region	922	934	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
low complexity region	1160	1171	N/A	INTRINSIC
low complexity region	1179	1198	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200317
AA Change: N303S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: N303S

Domain	Start	End	E-Value	Type
ZnF_C2H2	56	80	2e-2	SMART
low complexity region	958	970	N/A	INTRINSIC
low complexity region	1155	1179	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1215	1234	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	G	17: 45,509,404	D248G	probably benign	Het
Abcc5	C	A	16: 20,389,389	V605F	probably benign	Het
AI314180	A	T	4: 58,875,444	D173E	probably damaging	Het
Als2	A	G	1: 59,185,247	Y1066H	probably damaging	Het
Apbb1	A	G	7: 105,559,520	S569P	probably damaging	Het
Apex1	T	G	14: 50,925,668	D69E	possibly damaging	Het
Atg13	A	T	2: 91,682,061	F288I	probably benign	Het
Atl3	A	G	19: 7,510,082	I121V	probably benign	Het
Atoh1	A	G	6: 64,729,729	E136G	probably benign	Het
Ccr7	T	C	11: 99,149,069	N9S	probably benign	Het
Cdhr1	A	C	14: 37,080,548	W653G	probably damaging	Het
Cln6	T	A	9: 62,849,183	M203K	probably benign	Het
Crnn	A	C	3: 93,146,944	I45L	possibly damaging	Het
Cse1l	C	A	2: 166,941,265	N743K	probably damaging	Het
Cyp1a2	A	G	9: 57,682,300	I77T	probably damaging	Het
D6Wsu163e	A	G	6: 126,966,969	I443V	probably benign	Het
Dnah7a	G	T	1: 53,501,598	T2539N	probably benign	Het
Fam13c	A	G	10: 70,553,039	E465G	probably damaging	Het
Fat4	G	C	3: 39,009,241	G4449R	probably damaging	Het
Fgd5	T	C	6: 92,038,210	L964S	probably damaging	Het
Fpr3	A	T	17: 17,970,869	Q134L	probably damaging	Het
Gm973	A	T	1: 59,552,426	Q323L	possibly damaging	Het
Gna15	A	G	10: 81,509,390	S214P	probably benign	Het
Iars2	A	T	1: 185,317,949	M446K	possibly damaging	Het
Kcnh7	A	G	2: 62,777,603	S545P	probably damaging	Het
Kif1a	G	T	1: 93,051,480	D928E	probably damaging	Het
Kif26a	C	T	12: 112,178,046	T1578M	possibly damaging	Het
Kif5a	A	G	10: 127,243,358		probably null	Het
Klhl31	T	A	9: 77,651,107	Y368*	probably null	Het
Krtap27-1	A	G	16: 88,671,428	V76A	possibly damaging	Het
Lamc1	A	T	1: 153,250,451	H498Q	probably damaging	Het
Ltbp4	A	T	7: 27,322,925	C924S	probably damaging	Het
Ltn1	T	C	16: 87,400,410	D1180G	probably benign	Het
Macf1	A	G	4: 123,684,132	C20R	unknown	Het
Mpp7	T	C	18: 7,403,327	R328G	probably benign	Het
Ncdn	A	T	4: 126,750,248	D260E	probably benign	Het
Nlrp9a	C	A	7: 26,558,231	L425M	possibly damaging	Het
Nop9	T	A	14: 55,750,135		probably null	Het
Nrip1	T	C	16: 76,292,728	E647G	possibly damaging	Het
Nt5c3	C	A	6: 56,897,808	M1I	probably null	Het
Olfr1314	A	G	2: 112,092,065	F212S	probably benign	Het
Olfr69	A	G	7: 103,768,271	I42T	probably benign	Het
Olfr892-ps1	T	C	9: 38,189,824	M33T	possibly damaging	Het
Patj	A	T	4: 98,539,073	I172F	unknown	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Ptprd	C	G	4: 75,954,078	A1134P	possibly damaging	Het
Rbm27	T	A	18: 42,314,098	Y469*	probably null	Het
Rbm33	A	G	5: 28,352,586	T266A	probably damaging	Het
Rcbtb2	C	T	14: 73,177,060	S437L	probably damaging	Het
Rcor3	A	T	1: 192,101,595	*448R	probably null	Het
Scn10a	T	C	9: 119,616,761	Y1442C	probably damaging	Het
Scn2a	A	T	2: 65,717,787	I1108F	probably damaging	Het
Scrn2	T	C	11: 97,032,136	I135T	probably damaging	Het
Sptan1	A	T	2: 30,030,712	M2380L	possibly damaging	Het
Tbc1d12	T	C	19: 38,836,998	S98P	probably benign	Het
Tmem106b	A	T	6: 13,082,431	T202S	probably damaging	Het
Tnfsf8	A	G	4: 63,834,213	V205A	probably benign	Het
Tor4a	A	T	2: 25,194,963	N309K	probably damaging	Het
Trbv4	A	G	6: 41,059,690	T50A	probably benign	Het
Tspyl4	A	G	10: 34,297,572	H20R	probably benign	Het
Tvp23b	T	C	11: 62,882,016	I31T	possibly damaging	Het
Vmn1r192	A	T	13: 22,187,231	F273Y	probably damaging	Het
Vmn2r6	T	A	3: 64,559,611	I156F	probably damaging	Het
Wnk4	T	C	11: 101,274,056	I737T	probably damaging	Het
Zfp329	A	T	7: 12,811,158	D146E	probably benign	Het
Zfp40	A	G	17: 23,175,577	F679L	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het

Other mutations in Zfp804b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01085:Zfp804b	APN	5	6770931	missense	probably damaging	1.00
IGL01726:Zfp804b	APN	5	7180707	intron	probably benign
IGL02020:Zfp804b	APN	5	6769118	missense	probably damaging	1.00
IGL02567:Zfp804b	APN	5	6769989	missense	probably benign	0.02
IGL02679:Zfp804b	APN	5	6771392	missense	possibly damaging	0.50
IGL03245:Zfp804b	APN	5	6772253	missense	possibly damaging	0.92
IGL03352:Zfp804b	APN	5	6770039	missense	probably benign	0.45
Flush	UTSW	5	6770217	missense	probably benign	0.27
gozinta	UTSW	5	6770153	missense	possibly damaging	0.90
healthy	UTSW	5	6770013	missense	probably benign	0.04
Paluka	UTSW	5	6770534	missense	probably benign
PIT4142001:Zfp804b	UTSW	5	6769422	missense	probably damaging	0.99
R0025:Zfp804b	UTSW	5	6771665	missense	probably damaging	1.00
R0044:Zfp804b	UTSW	5	6769655	missense	probably damaging	1.00
R0137:Zfp804b	UTSW	5	6770534	missense	probably benign
R0330:Zfp804b	UTSW	5	6771029	missense	possibly damaging	0.83
R0330:Zfp804b	UTSW	5	6771994	missense	possibly damaging	0.63
R0522:Zfp804b	UTSW	5	6772014	missense	probably benign	0.05
R1463:Zfp804b	UTSW	5	7179372	intron	probably benign
R1497:Zfp804b	UTSW	5	6771105	missense	probably damaging	0.97
R1511:Zfp804b	UTSW	5	6769771	missense	possibly damaging	0.87
R1633:Zfp804b	UTSW	5	7179513	intron	probably benign
R1666:Zfp804b	UTSW	5	6771323	missense	possibly damaging	0.93
R1668:Zfp804b	UTSW	5	6771323	missense	possibly damaging	0.93
R1677:Zfp804b	UTSW	5	7179533	intron	probably benign
R1698:Zfp804b	UTSW	5	6769509	missense	probably damaging	1.00
R1716:Zfp804b	UTSW	5	6769673	missense	probably benign	0.00
R1730:Zfp804b	UTSW	5	6771938	missense	probably damaging	0.99
R1747:Zfp804b	UTSW	5	6770217	missense	probably benign	0.27
R1776:Zfp804b	UTSW	5	6769806	missense	probably damaging	1.00
R1783:Zfp804b	UTSW	5	6771938	missense	probably damaging	0.99
R1804:Zfp804b	UTSW	5	6771756	missense	possibly damaging	0.78
R1885:Zfp804b	UTSW	5	6770376	missense	probably damaging	0.97
R1887:Zfp804b	UTSW	5	6770376	missense	probably damaging	0.97
R1900:Zfp804b	UTSW	5	6769283	missense	probably damaging	0.99
R1929:Zfp804b	UTSW	5	6769748	missense	probably benign	0.05
R2141:Zfp804b	UTSW	5	6772583	missense	probably benign	0.11
R2181:Zfp804b	UTSW	5	6771674	missense	probably damaging	1.00
R2401:Zfp804b	UTSW	5	6769445	missense	probably damaging	1.00
R2408:Zfp804b	UTSW	5	7179410	intron	probably benign
R3237:Zfp804b	UTSW	5	6769239	missense	probably benign
R3429:Zfp804b	UTSW	5	7180625	intron	probably benign
R3785:Zfp804b	UTSW	5	6770153	missense	possibly damaging	0.90
R4459:Zfp804b	UTSW	5	6771481	missense	probably damaging	0.99
R4460:Zfp804b	UTSW	5	6771481	missense	probably damaging	0.99
R4608:Zfp804b	UTSW	5	6772584	missense	probably benign	0.04
R4762:Zfp804b	UTSW	5	6772250	missense	probably benign	0.00
R4871:Zfp804b	UTSW	5	6876479	missense	probably damaging	1.00
R4910:Zfp804b	UTSW	5	6770540	missense	possibly damaging	0.69
R4973:Zfp804b	UTSW	5	6771198	missense	probably damaging	0.99
R5199:Zfp804b	UTSW	5	6770013	missense	probably benign	0.04
R5219:Zfp804b	UTSW	5	6770703	missense	probably benign	0.01
R5411:Zfp804b	UTSW	5	6770071	missense	probably benign	0.00
R6001:Zfp804b	UTSW	5	6769043	missense	probably benign	0.00
R6041:Zfp804b	UTSW	5	6771231	missense	probably benign	0.08
R6151:Zfp804b	UTSW	5	6769910	missense	probably benign
R6252:Zfp804b	UTSW	5	6769478	missense	probably damaging	0.99
R6283:Zfp804b	UTSW	5	6769908	missense	probably benign	0.01
R6346:Zfp804b	UTSW	5	6770534	missense	probably benign
R6520:Zfp804b	UTSW	5	6769283	missense	probably damaging	0.99
R6714:Zfp804b	UTSW	5	6769239	missense	probably benign	0.00
R6924:Zfp804b	UTSW	5	6769902	missense	probably benign	0.09
R6966:Zfp804b	UTSW	5	6771615	missense	probably damaging	1.00
R7027:Zfp804b	UTSW	5	6770372	missense	probably benign
R7042:Zfp804b	UTSW	5	6770042	missense	probably benign	0.00
R7076:Zfp804b	UTSW	5	6769751	missense	probably benign	0.02
R7099:Zfp804b	UTSW	5	6772161	missense	probably benign	0.37
R7574:Zfp804b	UTSW	5	6772301	missense	possibly damaging	0.74
R7609:Zfp804b	UTSW	5	6770066	missense	possibly damaging	0.90
R7654:Zfp804b	UTSW	5	6769458	missense	probably damaging	0.97
R7669:Zfp804b	UTSW	5	6769362	missense	probably damaging	1.00
R7717:Zfp804b	UTSW	5	6771293	missense	possibly damaging	0.50
R7721:Zfp804b	UTSW	5	6771263	missense	possibly damaging	0.55
R7830:Zfp804b	UTSW	5	6771124	missense	probably benign
R7937:Zfp804b	UTSW	5	6771866	missense	possibly damaging	0.49
R7941:Zfp804b	UTSW	5	6770042	missense	probably benign	0.00
R8093:Zfp804b	UTSW	5	6770082	missense	probably benign	0.02
R8275:Zfp804b	UTSW	5	6772289	missense	probably benign	0.00
R8714:Zfp804b	UTSW	5	6772378	nonsense	probably null
R8788:Zfp804b	UTSW	5	6772635	missense	probably benign	0.00
R9223:Zfp804b	UTSW	5	6771496	missense	probably benign	0.02
R9276:Zfp804b	UTSW	5	6771398	missense	probably damaging	0.96
R9285:Zfp804b	UTSW	5	6770723	missense	probably benign	0.02
R9534:Zfp804b	UTSW	5	6769115	missense	probably damaging	1.00
X0027:Zfp804b	UTSW	5	6771257	missense	probably benign	0.00

Predicted Primers

Posted On

2022-02-07