Incidental Mutation 'R9206:Plxna4'
ID 698518
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Name plexin A4
Synonyms Plxa4
MMRRC Submission
Accession Numbers

Genbank: NM_175750

Essential gene? Possibly non essential (E-score: 0.373) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 32144268-32588192 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32517444 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 79 (V79D)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
AlphaFold Q80UG2
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: V79D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: V79D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150314
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 D248G probably benign Het
Abcc5 C A 16: 20,389,389 V605F probably benign Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Als2 A G 1: 59,185,247 Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Apex1 T G 14: 50,925,668 D69E possibly damaging Het
Atg13 A T 2: 91,682,061 F288I probably benign Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
Atoh1 A G 6: 64,729,729 E136G probably benign Het
Ccr7 T C 11: 99,149,069 N9S probably benign Het
Cdhr1 A C 14: 37,080,548 W653G probably damaging Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Crnn A C 3: 93,146,944 I45L possibly damaging Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dnah7a G T 1: 53,501,598 T2539N probably benign Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fat4 G C 3: 39,009,241 G4449R probably damaging Het
Fgd5 T C 6: 92,038,210 L964S probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm973 A T 1: 59,552,426 Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Iars2 A T 1: 185,317,949 M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 S545P probably damaging Het
Kif1a G T 1: 93,051,480 D928E probably damaging Het
Kif26a C T 12: 112,178,046 T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 probably null Het
Klhl31 T A 9: 77,651,107 Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 C924S probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nlrp9a C A 7: 26,558,231 L425M possibly damaging Het
Nop9 T A 14: 55,750,135 probably null Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Nt5c3 C A 6: 56,897,808 M1I probably null Het
Olfr1314 A G 2: 112,092,065 F212S probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 Y469* probably null Het
Rbm33 A G 5: 28,352,586 T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rcor3 A T 1: 192,101,595 *448R probably null Het
Scn10a T C 9: 119,616,761 Y1442C probably damaging Het
Scn2a A T 2: 65,717,787 I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 I135T probably damaging Het
Sptan1 A T 2: 30,030,712 M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 S98P probably benign Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Tor4a A T 2: 25,194,963 N309K probably damaging Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Tvp23b T C 11: 62,882,016 I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r6 T A 3: 64,559,611 I156F probably damaging Het
Wnk4 T C 11: 101,274,056 I737T probably damaging Het
Zfp329 A T 7: 12,811,158 D146E probably benign Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp804b T C 5: 6,772,154 N303S probably benign Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
corona UTSW 6 32517264 missense probably damaging 1.00
Disposed UTSW 6 32516505 missense probably damaging 1.00
inclined UTSW 6 32237723 nonsense probably null
Slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 splice site probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32196122 critical splice donor site probably null
R7383:Plxna4 UTSW 6 32152799 critical splice donor site probably null
R7405:Plxna4 UTSW 6 32196319 missense probably benign 0.00
R7516:Plxna4 UTSW 6 32237768 missense probably benign 0.00
R7635:Plxna4 UTSW 6 32496741 missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32152872 missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32223980 missense probably damaging 0.99
R7789:Plxna4 UTSW 6 32206233 critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32517046 missense probably damaging 0.99
R8191:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R8225:Plxna4 UTSW 6 32162103 missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32152854 missense probably benign 0.25
R8305:Plxna4 UTSW 6 32211065 missense possibly damaging 0.81
R8438:Plxna4 UTSW 6 32202180 missense probably damaging 1.00
R8493:Plxna4 UTSW 6 32215712 missense probably benign 0.27
R8714:Plxna4 UTSW 6 32163444 nonsense probably null
R8759:Plxna4 UTSW 6 32192341 missense probably damaging 1.00
R8822:Plxna4 UTSW 6 32150496 missense possibly damaging 0.89
R8844:Plxna4 UTSW 6 32197091 missense probably benign 0.11
R8974:Plxna4 UTSW 6 32239512 missense possibly damaging 0.79
R9020:Plxna4 UTSW 6 32234562 missense possibly damaging 0.90
R9144:Plxna4 UTSW 6 32185561 missense possibly damaging 0.77
R9208:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R9257:Plxna4 UTSW 6 32162083 missense probably damaging 0.99
R9269:Plxna4 UTSW 6 32178380 missense probably benign 0.00
R9411:Plxna4 UTSW 6 32182747 missense probably damaging 1.00
R9469:Plxna4 UTSW 6 32517591 missense probably benign
R9583:Plxna4 UTSW 6 32215234 missense possibly damaging 0.78
R9647:Plxna4 UTSW 6 32251109 missense probably damaging 1.00
R9695:Plxna4 UTSW 6 32206121 missense probably benign 0.02
R9801:Plxna4 UTSW 6 32163591 critical splice acceptor site probably null
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTGCAGATACCCTGGTAC -3'
(R):5'- AGATGAAAGCCATGCCCTG -3'

Sequencing Primer
(F):5'- TGGTACAGGCTCCCACAC -3'
(R):5'- TGGAACTGGACTTGCCTGCTC -3'
Posted On 2022-02-07