Incidental Mutation 'R9206:Plxna4'
ID 698518
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Name plexin A4
Synonyms Plxa4
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.600) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 32121478-32565127 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32494379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 79 (V79D)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
AlphaFold Q80UG2
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: V79D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: V79D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150314
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,820,330 (GRCm39) D248G probably benign Het
Abcc5 C A 16: 20,208,139 (GRCm39) V605F probably benign Het
Als2 A G 1: 59,224,406 (GRCm39) Y1066H probably damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Apex1 T G 14: 51,163,125 (GRCm39) D69E possibly damaging Het
Atg13 A T 2: 91,512,406 (GRCm39) F288I probably benign Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
Atoh1 A G 6: 64,706,713 (GRCm39) E136G probably benign Het
Ccr7 T C 11: 99,039,895 (GRCm39) N9S probably benign Het
Cdhr1 A C 14: 36,802,505 (GRCm39) W653G probably damaging Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Crnn A C 3: 93,054,251 (GRCm39) I45L possibly damaging Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dnah7a G T 1: 53,540,757 (GRCm39) T2539N probably benign Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fat4 G C 3: 39,063,390 (GRCm39) G4449R probably damaging Het
Fgd5 T C 6: 92,015,191 (GRCm39) L964S probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm973 A T 1: 59,591,585 (GRCm39) Q323L possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Iars2 A T 1: 185,050,146 (GRCm39) M446K possibly damaging Het
Kcnh7 A G 2: 62,607,947 (GRCm39) S545P probably damaging Het
Kif1a G T 1: 92,979,202 (GRCm39) D928E probably damaging Het
Kif26a C T 12: 112,144,480 (GRCm39) T1578M possibly damaging Het
Kif5a A G 10: 127,079,227 (GRCm39) probably null Het
Klhl31 T A 9: 77,558,389 (GRCm39) Y368* probably null Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lamc1 A T 1: 153,126,197 (GRCm39) H498Q probably damaging Het
Ltbp4 A T 7: 27,022,350 (GRCm39) C924S probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nlrp9a C A 7: 26,257,656 (GRCm39) L425M possibly damaging Het
Nop9 T A 14: 55,987,592 (GRCm39) probably null Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Nt5c3 C A 6: 56,874,793 (GRCm39) M1I probably null Het
Or4f61 A G 2: 111,922,410 (GRCm39) F212S probably benign Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rbm27 T A 18: 42,447,163 (GRCm39) Y469* probably null Het
Rbm33 A G 5: 28,557,584 (GRCm39) T266A probably damaging Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Rcor3 A T 1: 191,785,895 (GRCm39) *448R probably null Het
Scn10a T C 9: 119,445,827 (GRCm39) Y1442C probably damaging Het
Scn2a A T 2: 65,548,131 (GRCm39) I1108F probably damaging Het
Scrn2 T C 11: 96,922,962 (GRCm39) I135T probably damaging Het
Sptan1 A T 2: 29,920,724 (GRCm39) M2380L possibly damaging Het
Tbc1d12 T C 19: 38,825,442 (GRCm39) S98P probably benign Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Tor4a A T 2: 25,084,975 (GRCm39) N309K probably damaging Het
Trbv4 A G 6: 41,036,624 (GRCm39) T50A probably benign Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Tvp23b T C 11: 62,772,842 (GRCm39) I31T possibly damaging Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Vmn2r6 T A 3: 64,467,032 (GRCm39) I156F probably damaging Het
Wnk4 T C 11: 101,164,882 (GRCm39) I737T probably damaging Het
Zfp329 A T 7: 12,545,085 (GRCm39) D146E probably benign Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp804b T C 5: 6,822,154 (GRCm39) N303S probably benign Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32,139,026 (GRCm39) missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32,216,368 (GRCm39) missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32,493,470 (GRCm39) missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32,134,936 (GRCm39) missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32,287,413 (GRCm39) missense probably benign 0.06
IGL01767:Plxna4 APN 6 32,214,613 (GRCm39) missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32,192,139 (GRCm39) missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32,192,576 (GRCm39) missense probably benign
IGL02299:Plxna4 APN 6 32,142,091 (GRCm39) missense probably benign 0.01
IGL02306:Plxna4 APN 6 32,183,059 (GRCm39) missense probably benign 0.19
IGL02312:Plxna4 APN 6 32,142,052 (GRCm39) missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32,129,840 (GRCm39) missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32,162,346 (GRCm39) missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32,494,541 (GRCm39) missense probably benign 0.03
IGL02701:Plxna4 APN 6 32,494,494 (GRCm39) missense probably benign 0.01
IGL02995:Plxna4 APN 6 32,493,530 (GRCm39) missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32,179,160 (GRCm39) missense probably benign 0.01
IGL03264:Plxna4 APN 6 32,155,337 (GRCm39) missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32,141,986 (GRCm39) splice site probably benign
IGL03382:Plxna4 APN 6 32,179,129 (GRCm39) missense probably benign 0.23
corona UTSW 6 32,494,199 (GRCm39) missense probably damaging 1.00
Disposed UTSW 6 32,493,440 (GRCm39) missense probably damaging 1.00
inclined UTSW 6 32,214,658 (GRCm39) nonsense probably null
Slope UTSW 6 32,211,541 (GRCm39) missense probably benign 0.00
G4846:Plxna4 UTSW 6 32,169,207 (GRCm39) missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32,174,009 (GRCm39) missense probably benign 0.00
R0200:Plxna4 UTSW 6 32,174,023 (GRCm39) missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32,214,703 (GRCm39) missense probably benign 0.01
R0468:Plxna4 UTSW 6 32,192,181 (GRCm39) missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32,179,054 (GRCm39) missense probably benign
R0542:Plxna4 UTSW 6 32,169,232 (GRCm39) missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32,134,950 (GRCm39) missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32,162,436 (GRCm39) missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32,174,091 (GRCm39) missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32,228,071 (GRCm39) missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32,201,087 (GRCm39) splice site probably null
R1569:Plxna4 UTSW 6 32,162,410 (GRCm39) missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32,494,379 (GRCm39) missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32,174,761 (GRCm39) missense probably benign 0.01
R2068:Plxna4 UTSW 6 32,494,551 (GRCm39) missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32,493,909 (GRCm39) missense probably benign 0.00
R2842:Plxna4 UTSW 6 32,192,566 (GRCm39) critical splice donor site probably null
R2849:Plxna4 UTSW 6 32,162,467 (GRCm39) missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32,493,972 (GRCm39) missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32,142,715 (GRCm39) missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32,192,589 (GRCm39) missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32,213,300 (GRCm39) nonsense probably null
R4276:Plxna4 UTSW 6 32,177,883 (GRCm39) missense probably benign 0.29
R4307:Plxna4 UTSW 6 32,140,444 (GRCm39) missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32,127,480 (GRCm39) nonsense probably null
R4478:Plxna4 UTSW 6 32,173,068 (GRCm39) missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32,473,831 (GRCm39) critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32,494,338 (GRCm39) missense probably benign 0.00
R4568:Plxna4 UTSW 6 32,129,873 (GRCm39) missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32,493,885 (GRCm39) missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32,142,779 (GRCm39) missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32,493,623 (GRCm39) missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32,142,697 (GRCm39) missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32,201,094 (GRCm39) splice site probably null
R5181:Plxna4 UTSW 6 32,493,932 (GRCm39) missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32,228,007 (GRCm39) missense probably benign 0.03
R5259:Plxna4 UTSW 6 32,493,956 (GRCm39) missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32,183,056 (GRCm39) missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32,494,218 (GRCm39) missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32,155,293 (GRCm39) missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32,183,165 (GRCm39) missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32,134,915 (GRCm39) missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32,214,658 (GRCm39) nonsense probably null
R5653:Plxna4 UTSW 6 32,494,551 (GRCm39) missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32,192,657 (GRCm39) missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32,214,711 (GRCm39) missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32,494,181 (GRCm39) missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32,211,541 (GRCm39) missense probably benign 0.00
R5973:Plxna4 UTSW 6 32,228,000 (GRCm39) splice site probably null
R6433:Plxna4 UTSW 6 32,192,613 (GRCm39) missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32,493,672 (GRCm39) missense probably benign
R6560:Plxna4 UTSW 6 32,192,613 (GRCm39) missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32,177,794 (GRCm39) missense probably benign 0.26
R6810:Plxna4 UTSW 6 32,287,457 (GRCm39) missense probably benign 0.18
R6985:Plxna4 UTSW 6 32,214,643 (GRCm39) missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32,169,204 (GRCm39) missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32,493,440 (GRCm39) missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32,494,199 (GRCm39) missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32,473,691 (GRCm39) missense probably benign 0.01
R7199:Plxna4 UTSW 6 32,192,113 (GRCm39) nonsense probably null
R7248:Plxna4 UTSW 6 32,139,095 (GRCm39) missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32,216,455 (GRCm39) missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32,173,057 (GRCm39) critical splice donor site probably null
R7383:Plxna4 UTSW 6 32,129,734 (GRCm39) critical splice donor site probably null
R7405:Plxna4 UTSW 6 32,173,254 (GRCm39) missense probably benign 0.00
R7516:Plxna4 UTSW 6 32,214,703 (GRCm39) missense probably benign 0.00
R7635:Plxna4 UTSW 6 32,473,676 (GRCm39) missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32,129,807 (GRCm39) missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32,200,915 (GRCm39) missense probably damaging 0.99
R7789:Plxna4 UTSW 6 32,183,168 (GRCm39) critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32,493,981 (GRCm39) missense probably damaging 0.99
R8191:Plxna4 UTSW 6 32,493,885 (GRCm39) missense possibly damaging 0.88
R8225:Plxna4 UTSW 6 32,139,038 (GRCm39) missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32,129,789 (GRCm39) missense probably benign 0.25
R8305:Plxna4 UTSW 6 32,188,000 (GRCm39) missense possibly damaging 0.81
R8438:Plxna4 UTSW 6 32,179,115 (GRCm39) missense probably damaging 1.00
R8493:Plxna4 UTSW 6 32,192,647 (GRCm39) missense probably benign 0.27
R8714:Plxna4 UTSW 6 32,140,379 (GRCm39) nonsense probably null
R8759:Plxna4 UTSW 6 32,169,276 (GRCm39) missense probably damaging 1.00
R8822:Plxna4 UTSW 6 32,127,431 (GRCm39) missense possibly damaging 0.89
R8844:Plxna4 UTSW 6 32,174,026 (GRCm39) missense probably benign 0.11
R8974:Plxna4 UTSW 6 32,216,447 (GRCm39) missense possibly damaging 0.79
R9020:Plxna4 UTSW 6 32,211,497 (GRCm39) missense possibly damaging 0.90
R9144:Plxna4 UTSW 6 32,162,496 (GRCm39) missense possibly damaging 0.77
R9208:Plxna4 UTSW 6 32,494,379 (GRCm39) missense probably damaging 0.98
R9257:Plxna4 UTSW 6 32,139,018 (GRCm39) missense probably damaging 0.99
R9269:Plxna4 UTSW 6 32,155,315 (GRCm39) missense probably benign 0.00
R9411:Plxna4 UTSW 6 32,159,682 (GRCm39) missense probably damaging 1.00
R9469:Plxna4 UTSW 6 32,494,526 (GRCm39) missense probably benign
R9583:Plxna4 UTSW 6 32,192,169 (GRCm39) missense possibly damaging 0.78
R9647:Plxna4 UTSW 6 32,228,044 (GRCm39) missense probably damaging 1.00
R9695:Plxna4 UTSW 6 32,183,056 (GRCm39) missense probably benign 0.02
R9801:Plxna4 UTSW 6 32,140,526 (GRCm39) critical splice acceptor site probably null
V1024:Plxna4 UTSW 6 32,211,509 (GRCm39) missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32,493,979 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTGCAGATACCCTGGTAC -3'
(R):5'- AGATGAAAGCCATGCCCTG -3'

Sequencing Primer
(F):5'- TGGTACAGGCTCCCACAC -3'
(R):5'- TGGAACTGGACTTGCCTGCTC -3'
Posted On 2022-02-07