Incidental Mutation 'R9206:Nt5c3'
ID 698520
Institutional Source Beutler Lab
Gene Symbol Nt5c3
Ensembl Gene ENSMUSG00000029780
Gene Name 5'-nucleotidase, cytosolic III
Synonyms Umph1, 2610206B05Rik, PN-1, p36, lupin, cN-III, 1600024P05Rik, PSN1, Umph-1, PN-I
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 56882400-56923932 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) C to A at 56897808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000098918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031793] [ENSMUST00000101367] [ENSMUST00000135558] [ENSMUST00000152447]
AlphaFold Q9D020
Predicted Effect probably benign
Transcript: ENSMUST00000031793
SMART Domains Protein: ENSMUSP00000031793
Gene: ENSMUSG00000029780

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:UMPH-1 86 331 5.6e-119 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101367
AA Change: M1I

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098918
Gene: ENSMUSG00000029780
AA Change: M1I

DomainStartEndE-ValueType
Pfam:UMPH-1 52 297 2.1e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135558
SMART Domains Protein: ENSMUSP00000145230
Gene: ENSMUSG00000029780

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152447
Predicted Effect probably benign
Transcript: ENSMUST00000205087
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 D248G probably benign Het
Abcc5 C A 16: 20,389,389 V605F probably benign Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Als2 A G 1: 59,185,247 Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Apex1 T G 14: 50,925,668 D69E possibly damaging Het
Atg13 A T 2: 91,682,061 F288I probably benign Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
Atoh1 A G 6: 64,729,729 E136G probably benign Het
Ccr7 T C 11: 99,149,069 N9S probably benign Het
Cdhr1 A C 14: 37,080,548 W653G probably damaging Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Crnn A C 3: 93,146,944 I45L possibly damaging Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dnah7a G T 1: 53,501,598 T2539N probably benign Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fat4 G C 3: 39,009,241 G4449R probably damaging Het
Fgd5 T C 6: 92,038,210 L964S probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm973 A T 1: 59,552,426 Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Iars2 A T 1: 185,317,949 M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 S545P probably damaging Het
Kif1a G T 1: 93,051,480 D928E probably damaging Het
Kif26a C T 12: 112,178,046 T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 probably null Het
Klhl31 T A 9: 77,651,107 Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 C924S probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nlrp9a C A 7: 26,558,231 L425M possibly damaging Het
Nop9 T A 14: 55,750,135 probably null Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Olfr1314 A G 2: 112,092,065 F212S probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 Y469* probably null Het
Rbm33 A G 5: 28,352,586 T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rcor3 A T 1: 192,101,595 *448R probably null Het
Scn10a T C 9: 119,616,761 Y1442C probably damaging Het
Scn2a A T 2: 65,717,787 I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 I135T probably damaging Het
Sptan1 A T 2: 30,030,712 M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 S98P probably benign Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Tor4a A T 2: 25,194,963 N309K probably damaging Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Tvp23b T C 11: 62,882,016 I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r6 T A 3: 64,559,611 I156F probably damaging Het
Wnk4 T C 11: 101,274,056 I737T probably damaging Het
Zfp329 A T 7: 12,811,158 D146E probably benign Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp804b T C 5: 6,772,154 N303S probably benign Het
Other mutations in Nt5c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Nt5c3 APN 6 56886685 missense probably damaging 1.00
IGL02819:Nt5c3 APN 6 56883733 missense probably damaging 1.00
R0426:Nt5c3 UTSW 6 56883812 missense probably benign
R0523:Nt5c3 UTSW 6 56883681 missense probably damaging 1.00
R0791:Nt5c3 UTSW 6 56886749 missense probably benign 0.02
R0792:Nt5c3 UTSW 6 56886749 missense probably benign 0.02
R1340:Nt5c3 UTSW 6 56883033 missense probably benign 0.02
R3703:Nt5c3 UTSW 6 56883667 unclassified probably benign
R5942:Nt5c3 UTSW 6 56897854 splice site probably null
R6047:Nt5c3 UTSW 6 56882979 missense probably damaging 0.99
R6894:Nt5c3 UTSW 6 56882973 nonsense probably null
R7923:Nt5c3 UTSW 6 56883042 missense probably benign 0.12
R8708:Nt5c3 UTSW 6 56897773 critical splice donor site probably null
R8753:Nt5c3 UTSW 6 56883692 missense probably damaging 1.00
R8937:Nt5c3 UTSW 6 56884716 missense probably damaging 1.00
R9198:Nt5c3 UTSW 6 56882970 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATTCCATGTCACTCAGCAAATGC -3'
(R):5'- GAGAGTGTCCAGCTCTTGATG -3'

Sequencing Primer
(F):5'- GCAAATGCGTGAGATTTTATTCTCTG -3'
(R):5'- ATTCTGTGCTGAATATGAAGCCTGC -3'
Posted On 2022-02-07