Mutagenetix > Incidental Mutation

Incidental Mutation 'R9206:Apbb1'

698528

Institutional Source

Beutler Lab

Gene Symbol

Apbb1

Ensembl Gene

ENSMUSG00000037032

Gene Name

amyloid beta (A4) precursor protein-binding, family B, member 1

Synonyms

Fe65, Rir

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9206 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105558483-105581653 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105559520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 569 (S569P)

Ref Sequence

ENSEMBL: ENSMUSP00000140973 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046983] [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000187057] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601]

AlphaFold

Q9QXJ1

Predicted Effect

probably benign
Transcript: ENSMUST00000046983

SMART Domains

Protein: ENSMUSP00000042187
Gene: ENSMUSG00000037049

Domain	Start	End	E-Value	Type
transmembrane domain	30	52	N/A	INTRINSIC
SapB	85	163	1.05e-7	SMART
low complexity region	177	196	N/A	INTRINSIC
Pfam:Metallophos	197	459	4.4e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000081165
AA Change: S571P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: S571P

Domain	Start	End	E-Value	Type
low complexity region	146	184	N/A	INTRINSIC
WW	254	285	6.23e-5	SMART
low complexity region	287	299	N/A	INTRINSIC
PTB	365	512	4.16e-38	SMART
PTB	538	667	1.76e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186814

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187057
AA Change: S346P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032
AA Change: S346P

Domain	Start	End	E-Value	Type
WW	31	62	3.7e-7	SMART
low complexity region	64	76	N/A	INTRINSIC
PTB	142	287	3.8e-41	SMART
PTB	313	442	9.5e-39	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188001

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188368
AA Change: S348P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032
AA Change: S348P

Domain	Start	End	E-Value	Type
WW	31	62	3.7e-7	SMART
low complexity region	64	76	N/A	INTRINSIC
PTB	142	289	1.8e-40	SMART
PTB	315	444	9.5e-39	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000189072
AA Change: S312P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032
AA Change: S312P

Domain	Start	End	E-Value	Type
Pfam:WW	1	24	8.1e-5	PFAM
low complexity region	28	40	N/A	INTRINSIC
PTB	106	253	1.8e-40	SMART
PTB	279	408	9.5e-39	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189265
AA Change: S96P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032
AA Change: S96P

Domain	Start	End	E-Value	Type
Pfam:PID	1	34	2.3e-6	PFAM
PTB	63	192	9.5e-39	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189378
AA Change: S569P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: S569P

Domain	Start	End	E-Value	Type
low complexity region	146	184	N/A	INTRINSIC
WW	254	285	6.23e-5	SMART
low complexity region	287	299	N/A	INTRINSIC
PTB	365	510	6.86e-39	SMART
PTB	536	665	1.76e-36	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190369
AA Change: S312P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032
AA Change: S312P

Domain	Start	End	E-Value	Type
Pfam:WW	1	24	8.1e-5	PFAM
low complexity region	28	40	N/A	INTRINSIC
PTB	106	253	1.8e-40	SMART
PTB	279	408	9.5e-39	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191011
AA Change: S569P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: S569P

Domain	Start	End	E-Value	Type
low complexity region	146	184	N/A	INTRINSIC
WW	254	285	6.23e-5	SMART
low complexity region	287	299	N/A	INTRINSIC
PTB	365	510	6.86e-39	SMART
PTB	536	665	1.76e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191601
AA Change: S571P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: S571P

Domain	Start	End	E-Value	Type
low complexity region	146	184	N/A	INTRINSIC
WW	254	285	3.7e-7	SMART
low complexity region	287	299	N/A	INTRINSIC
PTB	365	512	1.8e-40	SMART
PTB	538	667	9.5e-39	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	G	17: 45,509,404	D248G	probably benign	Het
Abcc5	C	A	16: 20,389,389	V605F	probably benign	Het
AI314180	A	T	4: 58,875,444	D173E	probably damaging	Het
Als2	A	G	1: 59,185,247	Y1066H	probably damaging	Het
Apex1	T	G	14: 50,925,668	D69E	possibly damaging	Het
Atg13	A	T	2: 91,682,061	F288I	probably benign	Het
Atl3	A	G	19: 7,510,082	I121V	probably benign	Het
Atoh1	A	G	6: 64,729,729	E136G	probably benign	Het
Ccr7	T	C	11: 99,149,069	N9S	probably benign	Het
Cdhr1	A	C	14: 37,080,548	W653G	probably damaging	Het
Cln6	T	A	9: 62,849,183	M203K	probably benign	Het
Crnn	A	C	3: 93,146,944	I45L	possibly damaging	Het
Cse1l	C	A	2: 166,941,265	N743K	probably damaging	Het
Cyp1a2	A	G	9: 57,682,300	I77T	probably damaging	Het
D6Wsu163e	A	G	6: 126,966,969	I443V	probably benign	Het
Dnah7a	G	T	1: 53,501,598	T2539N	probably benign	Het
Fam13c	A	G	10: 70,553,039	E465G	probably damaging	Het
Fat4	G	C	3: 39,009,241	G4449R	probably damaging	Het
Fgd5	T	C	6: 92,038,210	L964S	probably damaging	Het
Fpr3	A	T	17: 17,970,869	Q134L	probably damaging	Het
Gm973	A	T	1: 59,552,426	Q323L	possibly damaging	Het
Gna15	A	G	10: 81,509,390	S214P	probably benign	Het
Iars2	A	T	1: 185,317,949	M446K	possibly damaging	Het
Kcnh7	A	G	2: 62,777,603	S545P	probably damaging	Het
Kif1a	G	T	1: 93,051,480	D928E	probably damaging	Het
Kif26a	C	T	12: 112,178,046	T1578M	possibly damaging	Het
Kif5a	A	G	10: 127,243,358		probably null	Het
Klhl31	T	A	9: 77,651,107	Y368*	probably null	Het
Krtap27-1	A	G	16: 88,671,428	V76A	possibly damaging	Het
Lamc1	A	T	1: 153,250,451	H498Q	probably damaging	Het
Ltbp4	A	T	7: 27,322,925	C924S	probably damaging	Het
Ltn1	T	C	16: 87,400,410	D1180G	probably benign	Het
Macf1	A	G	4: 123,684,132	C20R	unknown	Het
Mpp7	T	C	18: 7,403,327	R328G	probably benign	Het
Ncdn	A	T	4: 126,750,248	D260E	probably benign	Het
Nlrp9a	C	A	7: 26,558,231	L425M	possibly damaging	Het
Nop9	T	A	14: 55,750,135		probably null	Het
Nrip1	T	C	16: 76,292,728	E647G	possibly damaging	Het
Nt5c3	C	A	6: 56,897,808	M1I	probably null	Het
Olfr1314	A	G	2: 112,092,065	F212S	probably benign	Het
Olfr69	A	G	7: 103,768,271	I42T	probably benign	Het
Olfr892-ps1	T	C	9: 38,189,824	M33T	possibly damaging	Het
Patj	A	T	4: 98,539,073	I172F	unknown	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Ptprd	C	G	4: 75,954,078	A1134P	possibly damaging	Het
Rbm27	T	A	18: 42,314,098	Y469*	probably null	Het
Rbm33	A	G	5: 28,352,586	T266A	probably damaging	Het
Rcbtb2	C	T	14: 73,177,060	S437L	probably damaging	Het
Rcor3	A	T	1: 192,101,595	*448R	probably null	Het
Scn10a	T	C	9: 119,616,761	Y1442C	probably damaging	Het
Scn2a	A	T	2: 65,717,787	I1108F	probably damaging	Het
Scrn2	T	C	11: 97,032,136	I135T	probably damaging	Het
Sptan1	A	T	2: 30,030,712	M2380L	possibly damaging	Het
Tbc1d12	T	C	19: 38,836,998	S98P	probably benign	Het
Tmem106b	A	T	6: 13,082,431	T202S	probably damaging	Het
Tnfsf8	A	G	4: 63,834,213	V205A	probably benign	Het
Tor4a	A	T	2: 25,194,963	N309K	probably damaging	Het
Trbv4	A	G	6: 41,059,690	T50A	probably benign	Het
Tspyl4	A	G	10: 34,297,572	H20R	probably benign	Het
Tvp23b	T	C	11: 62,882,016	I31T	possibly damaging	Het
Vmn1r192	A	T	13: 22,187,231	F273Y	probably damaging	Het
Vmn2r6	T	A	3: 64,559,611	I156F	probably damaging	Het
Wnk4	T	C	11: 101,274,056	I737T	probably damaging	Het
Zfp329	A	T	7: 12,811,158	D146E	probably benign	Het
Zfp40	A	G	17: 23,175,577	F679L	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp804b	T	C	5: 6,772,154	N303S	probably benign	Het

Other mutations in Apbb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02171:Apbb1	APN	7	105559126	splice site	probably benign
athena	UTSW	7	105566695	missense	probably benign
R0092:Apbb1	UTSW	7	105559154	missense	probably damaging	1.00
R0348:Apbb1	UTSW	7	105565303	missense	probably damaging	0.98
R0633:Apbb1	UTSW	7	105558963	missense	probably damaging	1.00
R0946:Apbb1	UTSW	7	105573855	missense	probably benign	0.09
R1076:Apbb1	UTSW	7	105573855	missense	probably benign	0.09
R1332:Apbb1	UTSW	7	105565543	missense	possibly damaging	0.74
R1658:Apbb1	UTSW	7	105574084	missense	probably damaging	1.00
R1739:Apbb1	UTSW	7	105574227	missense	probably benign
R4230:Apbb1	UTSW	7	105567684	missense	probably damaging	1.00
R4296:Apbb1	UTSW	7	105573826	missense	probably benign	0.16
R4385:Apbb1	UTSW	7	105567276	missense	probably benign	0.00
R4571:Apbb1	UTSW	7	105573762	missense	probably damaging	1.00
R4647:Apbb1	UTSW	7	105565538	missense	probably benign	0.01
R4812:Apbb1	UTSW	7	105574025	missense	probably damaging	0.99
R5044:Apbb1	UTSW	7	105565682	intron	probably benign
R5109:Apbb1	UTSW	7	105565035	missense	probably damaging	1.00
R5479:Apbb1	UTSW	7	105565025	missense	probably damaging	0.97
R5611:Apbb1	UTSW	7	105559483	missense	probably damaging	1.00
R5677:Apbb1	UTSW	7	105559246	missense	probably damaging	1.00
R5785:Apbb1	UTSW	7	105567715	missense	probably damaging	1.00
R5850:Apbb1	UTSW	7	105567583	missense	probably damaging	1.00
R5896:Apbb1	UTSW	7	105574225	missense	probably damaging	1.00
R6151:Apbb1	UTSW	7	105574252	nonsense	probably null
R6186:Apbb1	UTSW	7	105567726	missense	probably damaging	1.00
R6229:Apbb1	UTSW	7	105573730	missense	probably damaging	0.98
R6229:Apbb1	UTSW	7	105573731	missense	probably damaging	0.98
R6288:Apbb1	UTSW	7	105559227	missense	probably damaging	1.00
R6295:Apbb1	UTSW	7	105566695	missense	probably benign
R6443:Apbb1	UTSW	7	105573763	missense	probably damaging	1.00
R6729:Apbb1	UTSW	7	105565381	missense	probably damaging	1.00
R7130:Apbb1	UTSW	7	105565331	missense	probably damaging	0.98
R7209:Apbb1	UTSW	7	105566085	missense	probably damaging	1.00
R7467:Apbb1	UTSW	7	105566132	missense	probably benign	0.04
R7489:Apbb1	UTSW	7	105567480	missense	probably benign	0.30
R7588:Apbb1	UTSW	7	105573966	missense	probably benign	0.29
R7754:Apbb1	UTSW	7	105559302	missense	probably damaging	0.97
R7768:Apbb1	UTSW	7	105567088	missense	probably benign
R7785:Apbb1	UTSW	7	105567423	missense	probably benign	0.00
R7804:Apbb1	UTSW	7	105566600	missense	probably damaging	1.00
R7809:Apbb1	UTSW	7	105573807	missense	probably benign	0.04
R7995:Apbb1	UTSW	7	105565645	missense	probably benign	0.09
R9208:Apbb1	UTSW	7	105559520	missense	probably damaging	0.97
R9225:Apbb1	UTSW	7	105568856	missense
Z1088:Apbb1	UTSW	7	105559136	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACCGCTTCTGTCTGTAG -3'
(R):5'- AGGGTCACGAGTCACTGAAGTC -3'

Sequencing Primer
(F):5'- ACCCCCTAACTCTATACTACTGG -3'
(R):5'- TCACTGAAGTCAAGGAGAGTGTC -3'

Posted On

2022-02-07