Incidental Mutation 'R9206:Cln6'
ID 698531
Institutional Source Beutler Lab
Gene Symbol Cln6
Ensembl Gene ENSMUSG00000032245
Gene Name ceroid-lipofuscinosis, neuronal 6
Synonyms D9Bwg1455e, 1810065L06Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 62838785-62852006 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62849183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 203 (M203K)
Ref Sequence ENSEMBL: ENSMUSP00000034776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034776] [ENSMUST00000141821]
AlphaFold Q3U466
Predicted Effect probably benign
Transcript: ENSMUST00000034776
AA Change: M203K

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034776
Gene: ENSMUSG00000032245
AA Change: M203K

DomainStartEndE-ValueType
Pfam:CLN6 27 306 1.3e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124984
SMART Domains Protein: ENSMUSP00000115675
Gene: ENSMUSG00000032245

DomainStartEndE-ValueType
Pfam:CLN6 1 64 1.3e-34 PFAM
Pfam:CLN6 68 189 2.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138276
Predicted Effect probably benign
Transcript: ENSMUST00000141821
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants have progressive retinal atrophy, limb paralysis, and seizures that lead to early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 D248G probably benign Het
Abcc5 C A 16: 20,389,389 V605F probably benign Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Als2 A G 1: 59,185,247 Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Apex1 T G 14: 50,925,668 D69E possibly damaging Het
Atg13 A T 2: 91,682,061 F288I probably benign Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
Atoh1 A G 6: 64,729,729 E136G probably benign Het
Ccr7 T C 11: 99,149,069 N9S probably benign Het
Cdhr1 A C 14: 37,080,548 W653G probably damaging Het
Crnn A C 3: 93,146,944 I45L possibly damaging Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dnah7a G T 1: 53,501,598 T2539N probably benign Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fat4 G C 3: 39,009,241 G4449R probably damaging Het
Fgd5 T C 6: 92,038,210 L964S probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm973 A T 1: 59,552,426 Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Iars2 A T 1: 185,317,949 M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 S545P probably damaging Het
Kif1a G T 1: 93,051,480 D928E probably damaging Het
Kif26a C T 12: 112,178,046 T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 probably null Het
Klhl31 T A 9: 77,651,107 Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 C924S probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nlrp9a C A 7: 26,558,231 L425M possibly damaging Het
Nop9 T A 14: 55,750,135 probably null Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Nt5c3 C A 6: 56,897,808 M1I probably null Het
Olfr1314 A G 2: 112,092,065 F212S probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 Y469* probably null Het
Rbm33 A G 5: 28,352,586 T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rcor3 A T 1: 192,101,595 *448R probably null Het
Scn10a T C 9: 119,616,761 Y1442C probably damaging Het
Scn2a A T 2: 65,717,787 I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 I135T probably damaging Het
Sptan1 A T 2: 30,030,712 M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 S98P probably benign Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Tor4a A T 2: 25,194,963 N309K probably damaging Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Tvp23b T C 11: 62,882,016 I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r6 T A 3: 64,559,611 I156F probably damaging Het
Wnk4 T C 11: 101,274,056 I737T probably damaging Het
Zfp329 A T 7: 12,811,158 D146E probably benign Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp804b T C 5: 6,772,154 N303S probably benign Het
Other mutations in Cln6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Cln6 APN 9 62844618 missense probably damaging 0.98
IGL01601:Cln6 APN 9 62846970 missense probably damaging 0.99
IGL02351:Cln6 APN 9 62847125 missense probably benign 0.01
IGL02358:Cln6 APN 9 62847125 missense probably benign 0.01
boost UTSW 9 62847093 missense probably damaging 1.00
R1113:Cln6 UTSW 9 62850861 missense probably damaging 1.00
R1308:Cln6 UTSW 9 62850861 missense probably damaging 1.00
R3690:Cln6 UTSW 9 62846970 missense possibly damaging 0.87
R3746:Cln6 UTSW 9 62847002 missense probably benign
R3898:Cln6 UTSW 9 62850652 missense probably damaging 1.00
R4576:Cln6 UTSW 9 62838949 missense probably benign 0.35
R4996:Cln6 UTSW 9 62850655 missense probably damaging 0.98
R5027:Cln6 UTSW 9 62847093 missense probably damaging 1.00
R6048:Cln6 UTSW 9 62844626 missense probably damaging 1.00
R7348:Cln6 UTSW 9 62849176 missense probably benign 0.14
R7450:Cln6 UTSW 9 62850630 missense probably damaging 1.00
R7565:Cln6 UTSW 9 62850757 missense possibly damaging 0.86
R7837:Cln6 UTSW 9 62849048 missense
R7982:Cln6 UTSW 9 62849168 missense possibly damaging 0.69
R9208:Cln6 UTSW 9 62849183 missense probably benign 0.24
R9210:Cln6 UTSW 9 62850691 missense probably damaging 1.00
R9212:Cln6 UTSW 9 62850691 missense probably damaging 1.00
R9311:Cln6 UTSW 9 62850618 missense probably damaging 1.00
R9369:Cln6 UTSW 9 62847149 missense probably damaging 0.98
R9618:Cln6 UTSW 9 62850829 missense probably damaging 0.99
R9627:Cln6 UTSW 9 62847021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATGCCAACACGGTGAC -3'
(R):5'- CCTCTCAAGGTGTCTAGCAACAG -3'

Sequencing Primer
(F):5'- CGGTGACACACTAGGACCAGTG -3'
(R):5'- TGTCCTGGAACTCTGTAGACCAAG -3'
Posted On 2022-02-07