Incidental Mutation 'R9206:Scn10a'
ID 698533
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Name sodium channel, voltage-gated, type X, alpha
Synonyms Nav1.8
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119608456-119719322 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119616761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1442 (Y1442C)
Ref Sequence ENSEMBL: ENSMUSP00000148987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084787
AA Change: Y1443C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: Y1443C

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213392
AA Change: Y1442C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214408
AA Change: Y1443C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 D248G probably benign Het
Abcc5 C A 16: 20,389,389 V605F probably benign Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Als2 A G 1: 59,185,247 Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Apex1 T G 14: 50,925,668 D69E possibly damaging Het
Atg13 A T 2: 91,682,061 F288I probably benign Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
Atoh1 A G 6: 64,729,729 E136G probably benign Het
Ccr7 T C 11: 99,149,069 N9S probably benign Het
Cdhr1 A C 14: 37,080,548 W653G probably damaging Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Crnn A C 3: 93,146,944 I45L possibly damaging Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dnah7a G T 1: 53,501,598 T2539N probably benign Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fat4 G C 3: 39,009,241 G4449R probably damaging Het
Fgd5 T C 6: 92,038,210 L964S probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm973 A T 1: 59,552,426 Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Iars2 A T 1: 185,317,949 M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 S545P probably damaging Het
Kif1a G T 1: 93,051,480 D928E probably damaging Het
Kif26a C T 12: 112,178,046 T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 probably null Het
Klhl31 T A 9: 77,651,107 Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 C924S probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nlrp9a C A 7: 26,558,231 L425M possibly damaging Het
Nop9 T A 14: 55,750,135 probably null Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Nt5c3 C A 6: 56,897,808 M1I probably null Het
Olfr1314 A G 2: 112,092,065 F212S probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 Y469* probably null Het
Rbm33 A G 5: 28,352,586 T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rcor3 A T 1: 192,101,595 *448R probably null Het
Scn2a A T 2: 65,717,787 I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 I135T probably damaging Het
Sptan1 A T 2: 30,030,712 M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 S98P probably benign Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Tor4a A T 2: 25,194,963 N309K probably damaging Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Tvp23b T C 11: 62,882,016 I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r6 T A 3: 64,559,611 I156F probably damaging Het
Wnk4 T C 11: 101,274,056 I737T probably damaging Het
Zfp329 A T 7: 12,811,158 D146E probably benign Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp804b T C 5: 6,772,154 N303S probably benign Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 missense probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 missense probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 missense probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 splice site probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
R6877:Scn10a UTSW 9 119609782 missense probably damaging 0.96
R6909:Scn10a UTSW 9 119609790 missense probably damaging 1.00
R7023:Scn10a UTSW 9 119613544 missense probably damaging 0.99
R7205:Scn10a UTSW 9 119613550 missense probably damaging 0.99
R7254:Scn10a UTSW 9 119618855 missense probably damaging 0.99
R7261:Scn10a UTSW 9 119609724 missense probably damaging 0.97
R7283:Scn10a UTSW 9 119664779 critical splice donor site probably null
R7453:Scn10a UTSW 9 119638552 missense probably benign
R7561:Scn10a UTSW 9 119694324 start codon destroyed probably null 0.66
R7590:Scn10a UTSW 9 119666400 missense probably damaging 1.00
R7759:Scn10a UTSW 9 119648132 nonsense probably null
R7765:Scn10a UTSW 9 119609904 missense possibly damaging 0.90
R7851:Scn10a UTSW 9 119617762 missense probably damaging 0.99
R7875:Scn10a UTSW 9 119635442 critical splice donor site probably null
R7975:Scn10a UTSW 9 119672220 missense probably benign 0.31
R8010:Scn10a UTSW 9 119661167 missense possibly damaging 0.56
R8027:Scn10a UTSW 9 119633790 missense probably damaging 0.99
R8221:Scn10a UTSW 9 119617763 missense probably damaging 1.00
R8249:Scn10a UTSW 9 119617774 missense probably damaging 1.00
R8319:Scn10a UTSW 9 119670389 missense probably benign 0.04
R8323:Scn10a UTSW 9 119609396 missense possibly damaging 0.95
R8539:Scn10a UTSW 9 119638774 nonsense probably null
R8679:Scn10a UTSW 9 119672128 missense probably damaging 0.97
R8680:Scn10a UTSW 9 119691443 critical splice donor site probably null
R8844:Scn10a UTSW 9 119617725 missense probably damaging 0.98
R9011:Scn10a UTSW 9 119630094 missense probably damaging 0.99
R9055:Scn10a UTSW 9 119622892 missense probably damaging 0.98
R9615:Scn10a UTSW 9 119658438 missense possibly damaging 0.55
R9622:Scn10a UTSW 9 119608980 missense probably benign 0.11
R9641:Scn10a UTSW 9 119616803 missense possibly damaging 0.60
R9651:Scn10a UTSW 9 119609997 missense probably benign 0.17
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Z1177:Scn10a UTSW 9 119624145 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTCACTATTGGGGCCTG -3'
(R):5'- AGTCTGCAATGGGCCATTC -3'

Sequencing Primer
(F):5'- GGGAGCCTCATCACTTCCAC -3'
(R):5'- ATTCCCTCTCAGGCCAGG -3'
Posted On 2022-02-07