Mutagenetix > Incidental Mutation

Incidental Mutation 'R9206:Kif5a'

698537

Institutional Source

Beutler Lab

Gene Symbol

Kif5a

Ensembl Gene

ENSMUSG00000074657

Gene Name

kinesin family member 5A

Synonyms

Khc, Kns, Kif5, D10Bwg0738e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9206 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

127225696-127263348 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 127243358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000096775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895] [ENSMUST00000218298]

AlphaFold

P33175

Predicted Effect

probably null
Transcript: ENSMUST00000099172

SMART Domains

Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657

Domain	Start	End	E-Value	Type
KISc	7	335	7.38e-173	SMART
low complexity region	340	362	N/A	INTRINSIC
coiled coil region	408	539	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
coiled coil region	632	800	N/A	INTRINSIC
coiled coil region	822	905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217895

Predicted Effect

probably benign
Transcript: ENSMUST00000218298

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	G	17: 45,509,404	D248G	probably benign	Het
Abcc5	C	A	16: 20,389,389	V605F	probably benign	Het
AI314180	A	T	4: 58,875,444	D173E	probably damaging	Het
Als2	A	G	1: 59,185,247	Y1066H	probably damaging	Het
Apbb1	A	G	7: 105,559,520	S569P	probably damaging	Het
Apex1	T	G	14: 50,925,668	D69E	possibly damaging	Het
Atg13	A	T	2: 91,682,061	F288I	probably benign	Het
Atl3	A	G	19: 7,510,082	I121V	probably benign	Het
Atoh1	A	G	6: 64,729,729	E136G	probably benign	Het
Ccr7	T	C	11: 99,149,069	N9S	probably benign	Het
Cdhr1	A	C	14: 37,080,548	W653G	probably damaging	Het
Cln6	T	A	9: 62,849,183	M203K	probably benign	Het
Crnn	A	C	3: 93,146,944	I45L	possibly damaging	Het
Cse1l	C	A	2: 166,941,265	N743K	probably damaging	Het
Cyp1a2	A	G	9: 57,682,300	I77T	probably damaging	Het
D6Wsu163e	A	G	6: 126,966,969	I443V	probably benign	Het
Dnah7a	G	T	1: 53,501,598	T2539N	probably benign	Het
Fam13c	A	G	10: 70,553,039	E465G	probably damaging	Het
Fat4	G	C	3: 39,009,241	G4449R	probably damaging	Het
Fgd5	T	C	6: 92,038,210	L964S	probably damaging	Het
Fpr3	A	T	17: 17,970,869	Q134L	probably damaging	Het
Gm973	A	T	1: 59,552,426	Q323L	possibly damaging	Het
Gna15	A	G	10: 81,509,390	S214P	probably benign	Het
Iars2	A	T	1: 185,317,949	M446K	possibly damaging	Het
Kcnh7	A	G	2: 62,777,603	S545P	probably damaging	Het
Kif1a	G	T	1: 93,051,480	D928E	probably damaging	Het
Kif26a	C	T	12: 112,178,046	T1578M	possibly damaging	Het
Klhl31	T	A	9: 77,651,107	Y368*	probably null	Het
Krtap27-1	A	G	16: 88,671,428	V76A	possibly damaging	Het
Lamc1	A	T	1: 153,250,451	H498Q	probably damaging	Het
Ltbp4	A	T	7: 27,322,925	C924S	probably damaging	Het
Ltn1	T	C	16: 87,400,410	D1180G	probably benign	Het
Macf1	A	G	4: 123,684,132	C20R	unknown	Het
Mpp7	T	C	18: 7,403,327	R328G	probably benign	Het
Ncdn	A	T	4: 126,750,248	D260E	probably benign	Het
Nlrp9a	C	A	7: 26,558,231	L425M	possibly damaging	Het
Nop9	T	A	14: 55,750,135		probably null	Het
Nrip1	T	C	16: 76,292,728	E647G	possibly damaging	Het
Nt5c3	C	A	6: 56,897,808	M1I	probably null	Het
Olfr1314	A	G	2: 112,092,065	F212S	probably benign	Het
Olfr69	A	G	7: 103,768,271	I42T	probably benign	Het
Olfr892-ps1	T	C	9: 38,189,824	M33T	possibly damaging	Het
Patj	A	T	4: 98,539,073	I172F	unknown	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Ptprd	C	G	4: 75,954,078	A1134P	possibly damaging	Het
Rbm27	T	A	18: 42,314,098	Y469*	probably null	Het
Rbm33	A	G	5: 28,352,586	T266A	probably damaging	Het
Rcbtb2	C	T	14: 73,177,060	S437L	probably damaging	Het
Rcor3	A	T	1: 192,101,595	*448R	probably null	Het
Scn10a	T	C	9: 119,616,761	Y1442C	probably damaging	Het
Scn2a	A	T	2: 65,717,787	I1108F	probably damaging	Het
Scrn2	T	C	11: 97,032,136	I135T	probably damaging	Het
Sptan1	A	T	2: 30,030,712	M2380L	possibly damaging	Het
Tbc1d12	T	C	19: 38,836,998	S98P	probably benign	Het
Tmem106b	A	T	6: 13,082,431	T202S	probably damaging	Het
Tnfsf8	A	G	4: 63,834,213	V205A	probably benign	Het
Tor4a	A	T	2: 25,194,963	N309K	probably damaging	Het
Trbv4	A	G	6: 41,059,690	T50A	probably benign	Het
Tspyl4	A	G	10: 34,297,572	H20R	probably benign	Het
Tvp23b	T	C	11: 62,882,016	I31T	possibly damaging	Het
Vmn1r192	A	T	13: 22,187,231	F273Y	probably damaging	Het
Vmn2r6	T	A	3: 64,559,611	I156F	probably damaging	Het
Wnk4	T	C	11: 101,274,056	I737T	probably damaging	Het
Zfp329	A	T	7: 12,811,158	D146E	probably benign	Het
Zfp40	A	G	17: 23,175,577	F679L	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp804b	T	C	5: 6,772,154	N303S	probably benign	Het

Other mutations in Kif5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Kif5a	APN	10	127239196	missense	probably benign
IGL01405:Kif5a	APN	10	127245990	missense	probably damaging	1.00
IGL01637:Kif5a	APN	10	127245368	missense	possibly damaging	0.94
IGL01894:Kif5a	APN	10	127262779	missense	probably benign	0.04
IGL01978:Kif5a	APN	10	127245739	missense	probably benign
IGL02039:Kif5a	APN	10	127233867	missense	possibly damaging	0.95
IGL02052:Kif5a	APN	10	127243499	missense	probably damaging	1.00
IGL02336:Kif5a	APN	10	127242696	missense	possibly damaging	0.87
IGL02352:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02359:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02834:Kif5a	APN	10	127245756	missense	probably benign	0.00
IGL03101:Kif5a	APN	10	127235609	unclassified	probably benign
brittany	UTSW	10	127248254	missense	probably damaging	1.00
spaniel	UTSW	10	127230578	missense	probably benign	0.00
R0463:Kif5a	UTSW	10	127235652	missense	probably benign	0.00
R0790:Kif5a	UTSW	10	127246009	intron	probably benign
R1070:Kif5a	UTSW	10	127245406	missense	probably benign	0.00
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1502:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R1812:Kif5a	UTSW	10	127242010	missense	probably benign	0.03
R1837:Kif5a	UTSW	10	127236815	nonsense	probably null
R1838:Kif5a	UTSW	10	127236815	nonsense	probably null
R2012:Kif5a	UTSW	10	127239175	missense	probably benign
R2072:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2073:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2074:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2075:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2440:Kif5a	UTSW	10	127231336	missense	probably benign	0.34
R3157:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R3688:Kif5a	UTSW	10	127242774	missense	probably damaging	1.00
R3740:Kif5a	UTSW	10	127243468	missense	probably damaging	1.00
R4782:Kif5a	UTSW	10	127230954	missense	probably benign	0.01
R5049:Kif5a	UTSW	10	127239839	missense	possibly damaging	0.93
R5723:Kif5a	UTSW	10	127231029	frame shift	probably null
R5764:Kif5a	UTSW	10	127231029	frame shift	probably null
R5838:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R5903:Kif5a	UTSW	10	127230578	missense	probably benign	0.00
R6299:Kif5a	UTSW	10	127233821	missense	probably damaging	1.00
R6384:Kif5a	UTSW	10	127242775	missense	probably damaging	1.00
R6629:Kif5a	UTSW	10	127248254	missense	probably damaging	1.00
R7463:Kif5a	UTSW	10	127243724	missense	probably damaging	0.97
R7558:Kif5a	UTSW	10	127248079	missense	probably damaging	1.00
R7567:Kif5a	UTSW	10	127237379	missense	probably benign	0.00
R7733:Kif5a	UTSW	10	127236740	missense	probably benign	0.00
R7853:Kif5a	UTSW	10	127235668	nonsense	probably null
R7869:Kif5a	UTSW	10	127243474	missense	probably damaging	1.00
R7896:Kif5a	UTSW	10	127242004	missense	probably benign
R8085:Kif5a	UTSW	10	127239309	missense	probably benign	0.00
R8426:Kif5a	UTSW	10	127231489	missense	probably damaging	0.99
R8750:Kif5a	UTSW	10	127248040	missense	probably damaging	1.00
R9497:Kif5a	UTSW	10	127243484	missense	probably damaging	1.00
R9747:Kif5a	UTSW	10	127238753	missense	probably benign	0.00
Z1177:Kif5a	UTSW	10	127229823	missense	probably benign	0.00
Z1177:Kif5a	UTSW	10	127236967	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGGCAGTCCTTGGTGAT -3'
(R):5'- GGTCTGCTCCTGCTCTAGA -3'

Sequencing Primer
(F):5'- TGCCTATGTGTGCCCATG -3'
(R):5'- TCCTGCTCTAGAAAAGCTACGTG -3'

Posted On

2022-02-07