Incidental Mutation 'R9206:Vmn1r192'
ID 698543
Institutional Source Beutler Lab
Gene Symbol Vmn1r192
Ensembl Gene ENSMUSG00000099787
Gene Name vomeronasal 1 receptor 192
Synonyms V1ri1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 22371316-22372218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22371401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 273 (F273Y)
Ref Sequence ENSEMBL: ENSMUSP00000072426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072632]
AlphaFold Q8K4C9
Predicted Effect probably damaging
Transcript: ENSMUST00000072632
AA Change: F273Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072426
Gene: ENSMUSG00000099787
AA Change: F273Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 2.6e-10 PFAM
Pfam:V1R 37 299 1.1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,820,330 (GRCm39) D248G probably benign Het
Abcc5 C A 16: 20,208,139 (GRCm39) V605F probably benign Het
Als2 A G 1: 59,224,406 (GRCm39) Y1066H probably damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Apex1 T G 14: 51,163,125 (GRCm39) D69E possibly damaging Het
Atg13 A T 2: 91,512,406 (GRCm39) F288I probably benign Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
Atoh1 A G 6: 64,706,713 (GRCm39) E136G probably benign Het
Ccr7 T C 11: 99,039,895 (GRCm39) N9S probably benign Het
Cdhr1 A C 14: 36,802,505 (GRCm39) W653G probably damaging Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Crnn A C 3: 93,054,251 (GRCm39) I45L possibly damaging Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dnah7a G T 1: 53,540,757 (GRCm39) T2539N probably benign Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fat4 G C 3: 39,063,390 (GRCm39) G4449R probably damaging Het
Fgd5 T C 6: 92,015,191 (GRCm39) L964S probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm973 A T 1: 59,591,585 (GRCm39) Q323L possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Iars2 A T 1: 185,050,146 (GRCm39) M446K possibly damaging Het
Kcnh7 A G 2: 62,607,947 (GRCm39) S545P probably damaging Het
Kif1a G T 1: 92,979,202 (GRCm39) D928E probably damaging Het
Kif26a C T 12: 112,144,480 (GRCm39) T1578M possibly damaging Het
Kif5a A G 10: 127,079,227 (GRCm39) probably null Het
Klhl31 T A 9: 77,558,389 (GRCm39) Y368* probably null Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lamc1 A T 1: 153,126,197 (GRCm39) H498Q probably damaging Het
Ltbp4 A T 7: 27,022,350 (GRCm39) C924S probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nlrp9a C A 7: 26,257,656 (GRCm39) L425M possibly damaging Het
Nop9 T A 14: 55,987,592 (GRCm39) probably null Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Nt5c3 C A 6: 56,874,793 (GRCm39) M1I probably null Het
Or4f61 A G 2: 111,922,410 (GRCm39) F212S probably benign Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Ptprd C G 4: 75,872,315 (GRCm39) A1134P possibly damaging Het
Rbm27 T A 18: 42,447,163 (GRCm39) Y469* probably null Het
Rbm33 A G 5: 28,557,584 (GRCm39) T266A probably damaging Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Rcor3 A T 1: 191,785,895 (GRCm39) *448R probably null Het
Scn10a T C 9: 119,445,827 (GRCm39) Y1442C probably damaging Het
Scn2a A T 2: 65,548,131 (GRCm39) I1108F probably damaging Het
Scrn2 T C 11: 96,922,962 (GRCm39) I135T probably damaging Het
Sptan1 A T 2: 29,920,724 (GRCm39) M2380L possibly damaging Het
Tbc1d12 T C 19: 38,825,442 (GRCm39) S98P probably benign Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Tor4a A T 2: 25,084,975 (GRCm39) N309K probably damaging Het
Trbv4 A G 6: 41,036,624 (GRCm39) T50A probably benign Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Tvp23b T C 11: 62,772,842 (GRCm39) I31T possibly damaging Het
Vmn2r6 T A 3: 64,467,032 (GRCm39) I156F probably damaging Het
Wnk4 T C 11: 101,164,882 (GRCm39) I737T probably damaging Het
Zfp329 A T 7: 12,545,085 (GRCm39) D146E probably benign Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp804b T C 5: 6,822,154 (GRCm39) N303S probably benign Het
Other mutations in Vmn1r192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Vmn1r192 APN 13 22,372,079 (GRCm39) missense probably damaging 1.00
IGL01869:Vmn1r192 APN 13 22,371,750 (GRCm39) missense probably damaging 1.00
R0975:Vmn1r192 UTSW 13 22,371,633 (GRCm39) missense probably damaging 1.00
R1751:Vmn1r192 UTSW 13 22,371,441 (GRCm39) missense probably benign 0.08
R1767:Vmn1r192 UTSW 13 22,371,441 (GRCm39) missense probably benign 0.08
R1880:Vmn1r192 UTSW 13 22,371,764 (GRCm39) missense probably benign 0.12
R1881:Vmn1r192 UTSW 13 22,371,764 (GRCm39) missense probably benign 0.12
R2113:Vmn1r192 UTSW 13 22,371,800 (GRCm39) missense possibly damaging 0.67
R4290:Vmn1r192 UTSW 13 22,371,465 (GRCm39) missense probably damaging 1.00
R4292:Vmn1r192 UTSW 13 22,371,465 (GRCm39) missense probably damaging 1.00
R4294:Vmn1r192 UTSW 13 22,371,465 (GRCm39) missense probably damaging 1.00
R4295:Vmn1r192 UTSW 13 22,371,465 (GRCm39) missense probably damaging 1.00
R4921:Vmn1r192 UTSW 13 22,371,650 (GRCm39) missense probably damaging 1.00
R5377:Vmn1r192 UTSW 13 22,371,801 (GRCm39) missense probably benign 0.01
R5569:Vmn1r192 UTSW 13 22,371,384 (GRCm39) missense possibly damaging 0.91
R6181:Vmn1r192 UTSW 13 22,371,452 (GRCm39) missense probably damaging 1.00
R6455:Vmn1r192 UTSW 13 22,372,000 (GRCm39) missense probably benign 0.08
R6860:Vmn1r192 UTSW 13 22,372,122 (GRCm39) missense probably benign
R7246:Vmn1r192 UTSW 13 22,371,944 (GRCm39) missense probably damaging 1.00
R7762:Vmn1r192 UTSW 13 22,371,845 (GRCm39) missense probably damaging 0.97
R8066:Vmn1r192 UTSW 13 22,371,565 (GRCm39) nonsense probably null
R8378:Vmn1r192 UTSW 13 22,372,029 (GRCm39) nonsense probably null
R9075:Vmn1r192 UTSW 13 22,371,333 (GRCm39) missense probably benign
R9208:Vmn1r192 UTSW 13 22,371,401 (GRCm39) missense probably damaging 1.00
R9313:Vmn1r192 UTSW 13 22,372,191 (GRCm39) missense probably benign 0.38
R9367:Vmn1r192 UTSW 13 22,371,800 (GRCm39) missense possibly damaging 0.67
R9694:Vmn1r192 UTSW 13 22,372,119 (GRCm39) missense probably benign
R9760:Vmn1r192 UTSW 13 22,372,010 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTGTTGCATGCAGACTG -3'
(R):5'- TTTACAGCTCCAGGTCTGC -3'

Sequencing Primer
(F):5'- CCAGGTCAATCTATGGTGCATAGC -3'
(R):5'- GGTCTGCAAACAACTCTGCTC -3'
Posted On 2022-02-07