Mutagenetix > Incidental Mutation

Incidental Mutation 'R9206:Aars2'

698555

Institutional Source

Beutler Lab

Gene Symbol

Aars2

Ensembl Gene

ENSMUSG00000023938

Gene Name

alanyl-tRNA synthetase 2, mitochondrial

Synonyms

Aarsl

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9206 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45506841-45520842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45509404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 248 (D248G)

Ref Sequence

ENSEMBL: ENSMUSP00000024733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024733]

AlphaFold

Q14CH7

Predicted Effect

probably benign
Transcript: ENSMUST00000024733
AA Change: D248G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: D248G

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:tRNA-synt_2c	36	619	4e-175	PFAM
low complexity region	663	674	N/A	INTRINSIC
tRNA_SAD	716	774	2.65e-10	SMART
coiled coil region	833	863	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	C	A	16: 20,389,389	V605F	probably benign	Het
AI314180	A	T	4: 58,875,444	D173E	probably damaging	Het
Als2	A	G	1: 59,185,247	Y1066H	probably damaging	Het
Apbb1	A	G	7: 105,559,520	S569P	probably damaging	Het
Apex1	T	G	14: 50,925,668	D69E	possibly damaging	Het
Atg13	A	T	2: 91,682,061	F288I	probably benign	Het
Atl3	A	G	19: 7,510,082	I121V	probably benign	Het
Atoh1	A	G	6: 64,729,729	E136G	probably benign	Het
Ccr7	T	C	11: 99,149,069	N9S	probably benign	Het
Cdhr1	A	C	14: 37,080,548	W653G	probably damaging	Het
Cln6	T	A	9: 62,849,183	M203K	probably benign	Het
Crnn	A	C	3: 93,146,944	I45L	possibly damaging	Het
Cse1l	C	A	2: 166,941,265	N743K	probably damaging	Het
Cyp1a2	A	G	9: 57,682,300	I77T	probably damaging	Het
D6Wsu163e	A	G	6: 126,966,969	I443V	probably benign	Het
Dnah7a	G	T	1: 53,501,598	T2539N	probably benign	Het
Fam13c	A	G	10: 70,553,039	E465G	probably damaging	Het
Fat4	G	C	3: 39,009,241	G4449R	probably damaging	Het
Fgd5	T	C	6: 92,038,210	L964S	probably damaging	Het
Fpr3	A	T	17: 17,970,869	Q134L	probably damaging	Het
Gm973	A	T	1: 59,552,426	Q323L	possibly damaging	Het
Gna15	A	G	10: 81,509,390	S214P	probably benign	Het
Iars2	A	T	1: 185,317,949	M446K	possibly damaging	Het
Kcnh7	A	G	2: 62,777,603	S545P	probably damaging	Het
Kif1a	G	T	1: 93,051,480	D928E	probably damaging	Het
Kif26a	C	T	12: 112,178,046	T1578M	possibly damaging	Het
Kif5a	A	G	10: 127,243,358		probably null	Het
Klhl31	T	A	9: 77,651,107	Y368*	probably null	Het
Krtap27-1	A	G	16: 88,671,428	V76A	possibly damaging	Het
Lamc1	A	T	1: 153,250,451	H498Q	probably damaging	Het
Ltbp4	A	T	7: 27,322,925	C924S	probably damaging	Het
Ltn1	T	C	16: 87,400,410	D1180G	probably benign	Het
Macf1	A	G	4: 123,684,132	C20R	unknown	Het
Mpp7	T	C	18: 7,403,327	R328G	probably benign	Het
Ncdn	A	T	4: 126,750,248	D260E	probably benign	Het
Nlrp9a	C	A	7: 26,558,231	L425M	possibly damaging	Het
Nop9	T	A	14: 55,750,135		probably null	Het
Nrip1	T	C	16: 76,292,728	E647G	possibly damaging	Het
Nt5c3	C	A	6: 56,897,808	M1I	probably null	Het
Olfr1314	A	G	2: 112,092,065	F212S	probably benign	Het
Olfr69	A	G	7: 103,768,271	I42T	probably benign	Het
Olfr892-ps1	T	C	9: 38,189,824	M33T	possibly damaging	Het
Patj	A	T	4: 98,539,073	I172F	unknown	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Ptprd	C	G	4: 75,954,078	A1134P	possibly damaging	Het
Rbm27	T	A	18: 42,314,098	Y469*	probably null	Het
Rbm33	A	G	5: 28,352,586	T266A	probably damaging	Het
Rcbtb2	C	T	14: 73,177,060	S437L	probably damaging	Het
Rcor3	A	T	1: 192,101,595	*448R	probably null	Het
Scn10a	T	C	9: 119,616,761	Y1442C	probably damaging	Het
Scn2a	A	T	2: 65,717,787	I1108F	probably damaging	Het
Scrn2	T	C	11: 97,032,136	I135T	probably damaging	Het
Sptan1	A	T	2: 30,030,712	M2380L	possibly damaging	Het
Tbc1d12	T	C	19: 38,836,998	S98P	probably benign	Het
Tmem106b	A	T	6: 13,082,431	T202S	probably damaging	Het
Tnfsf8	A	G	4: 63,834,213	V205A	probably benign	Het
Tor4a	A	T	2: 25,194,963	N309K	probably damaging	Het
Trbv4	A	G	6: 41,059,690	T50A	probably benign	Het
Tspyl4	A	G	10: 34,297,572	H20R	probably benign	Het
Tvp23b	T	C	11: 62,882,016	I31T	possibly damaging	Het
Vmn1r192	A	T	13: 22,187,231	F273Y	probably damaging	Het
Vmn2r6	T	A	3: 64,559,611	I156F	probably damaging	Het
Wnk4	T	C	11: 101,274,056	I737T	probably damaging	Het
Zfp329	A	T	7: 12,811,158	D146E	probably benign	Het
Zfp40	A	G	17: 23,175,577	F679L	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp804b	T	C	5: 6,772,154	N303S	probably benign	Het

Other mutations in Aars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02958:Aars2	APN	17	45518172	missense	probably benign	0.00
dread_pirate	UTSW	17	45516564	missense	probably damaging	1.00
R0266:Aars2	UTSW	17	45507510	splice site	probably benign
R0315:Aars2	UTSW	17	45515452	missense	possibly damaging	0.67
R0375:Aars2	UTSW	17	45514550	missense	probably damaging	0.99
R0629:Aars2	UTSW	17	45507547	missense	probably damaging	0.99
R0981:Aars2	UTSW	17	45520331	missense	probably damaging	1.00
R1878:Aars2	UTSW	17	45514638	critical splice donor site	probably null
R1893:Aars2	UTSW	17	45514799	missense	probably benign	0.14
R2035:Aars2	UTSW	17	45514801	missense	possibly damaging	0.87
R2099:Aars2	UTSW	17	45506894	missense	unknown
R4342:Aars2	UTSW	17	45516495	missense	probably benign
R4600:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R4601:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R4610:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R5158:Aars2	UTSW	17	45514829	missense	probably benign	0.07
R5943:Aars2	UTSW	17	45517711	missense	probably benign	0.30
R5992:Aars2	UTSW	17	45508623	nonsense	probably null
R6255:Aars2	UTSW	17	45514609	missense	probably damaging	1.00
R6381:Aars2	UTSW	17	45518545	missense	probably benign	0.04
R6392:Aars2	UTSW	17	45514600	missense	probably damaging	0.98
R6406:Aars2	UTSW	17	45506939	missense	probably benign	0.16
R6648:Aars2	UTSW	17	45516564	missense	probably damaging	1.00
R7135:Aars2	UTSW	17	45508961	nonsense	probably null
R7197:Aars2	UTSW	17	45508959	missense	probably damaging	1.00
R7203:Aars2	UTSW	17	45516571	missense	probably damaging	1.00
R7289:Aars2	UTSW	17	45507624	missense	probably damaging	0.99
R7669:Aars2	UTSW	17	45520295	missense	probably benign	0.06
R8303:Aars2	UTSW	17	45507597	missense	probably damaging	1.00
R8772:Aars2	UTSW	17	45516977	missense	probably benign	0.19
R8795:Aars2	UTSW	17	45507672	missense	probably damaging	0.99
R9069:Aars2	UTSW	17	45507597	missense	probably damaging	1.00
R9342:Aars2	UTSW	17	45507076	missense	possibly damaging	0.94
R9467:Aars2	UTSW	17	45516484	missense	probably benign	0.01
R9730:Aars2	UTSW	17	45518608	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTTGGCAGGTCTCTCTAAAG -3'
(R):5'- GTTTTCAACAATACCAGGGGAG -3'

Sequencing Primer
(F):5'- CTTGGCAGGTCTCTCTAAAGACAAAG -3'
(R):5'- GTGTTTACCTCATAAGCACCAGG -3'

Posted On

2022-02-07