Incidental Mutation 'R9206:Mpp7'
ID 698556
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Name membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms 2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 7347962-7626863 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7403327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 328 (R328G)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000115869
AA Change: R328G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: R328G

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 D248G probably benign Het
Abcc5 C A 16: 20,389,389 V605F probably benign Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Als2 A G 1: 59,185,247 Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Apex1 T G 14: 50,925,668 D69E possibly damaging Het
Atg13 A T 2: 91,682,061 F288I probably benign Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
Atoh1 A G 6: 64,729,729 E136G probably benign Het
Ccr7 T C 11: 99,149,069 N9S probably benign Het
Cdhr1 A C 14: 37,080,548 W653G probably damaging Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Crnn A C 3: 93,146,944 I45L possibly damaging Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dnah7a G T 1: 53,501,598 T2539N probably benign Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fat4 G C 3: 39,009,241 G4449R probably damaging Het
Fgd5 T C 6: 92,038,210 L964S probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm973 A T 1: 59,552,426 Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Iars2 A T 1: 185,317,949 M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 S545P probably damaging Het
Kif1a G T 1: 93,051,480 D928E probably damaging Het
Kif26a C T 12: 112,178,046 T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 probably null Het
Klhl31 T A 9: 77,651,107 Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 C924S probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nlrp9a C A 7: 26,558,231 L425M possibly damaging Het
Nop9 T A 14: 55,750,135 probably null Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Nt5c3 C A 6: 56,897,808 M1I probably null Het
Olfr1314 A G 2: 112,092,065 F212S probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 Y469* probably null Het
Rbm33 A G 5: 28,352,586 T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rcor3 A T 1: 192,101,595 *448R probably null Het
Scn10a T C 9: 119,616,761 Y1442C probably damaging Het
Scn2a A T 2: 65,717,787 I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 I135T probably damaging Het
Sptan1 A T 2: 30,030,712 M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 S98P probably benign Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Tor4a A T 2: 25,194,963 N309K probably damaging Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Tvp23b T C 11: 62,882,016 I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r6 T A 3: 64,559,611 I156F probably damaging Het
Wnk4 T C 11: 101,274,056 I737T probably damaging Het
Zfp329 A T 7: 12,811,158 D146E probably benign Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp804b T C 5: 6,772,154 N303S probably benign Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7353297 missense probably benign 0.00
IGL01575:Mpp7 APN 18 7403365 splice site probably benign
IGL02973:Mpp7 APN 18 7403297 missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7461637 critical splice donor site probably null
IGL03224:Mpp7 APN 18 7403269 missense probably benign 0.28
IGL03248:Mpp7 APN 18 7403269 missense probably benign 0.28
R0040:Mpp7 UTSW 18 7403180 splice site probably benign
R0089:Mpp7 UTSW 18 7439555 splice site probably benign
R1413:Mpp7 UTSW 18 7350977 missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7350984 missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7350967 makesense probably null
R2379:Mpp7 UTSW 18 7403345 nonsense probably null
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7351085 missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7444062 missense probably benign 0.23
R4574:Mpp7 UTSW 18 7353228 missense probably benign 0.02
R4772:Mpp7 UTSW 18 7379983 splice site probably null
R5066:Mpp7 UTSW 18 7513002 missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7458930 critical splice donor site probably null
R5451:Mpp7 UTSW 18 7442855 missense probably null 0.95
R5578:Mpp7 UTSW 18 7355101 missense probably benign
R5651:Mpp7 UTSW 18 7355016 critical splice donor site probably null
R5787:Mpp7 UTSW 18 7461682 missense probably benign
R6979:Mpp7 UTSW 18 7355049 missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7441623 missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7351079 missense probably damaging 0.98
R7517:Mpp7 UTSW 18 7440183 nonsense probably null
R8278:Mpp7 UTSW 18 7444025 missense probably benign
R8373:Mpp7 UTSW 18 7444096 missense probably damaging 1.00
R8676:Mpp7 UTSW 18 7440430 critical splice donor site probably null
R9208:Mpp7 UTSW 18 7403327 missense probably benign 0.12
R9439:Mpp7 UTSW 18 7461692 nonsense probably null
R9790:Mpp7 UTSW 18 7355049 missense probably benign 0.07
R9791:Mpp7 UTSW 18 7355049 missense probably benign 0.07
X0028:Mpp7 UTSW 18 7403273 missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7355062 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGATGAAGGGAATTTTAGCTTG -3'
(R):5'- TCTCACCAGCCGTCGATATC -3'

Sequencing Primer
(F):5'- TTTGTCATGGATCTGCCG -3'
(R):5'- AGCCGTCGATATCCTTTTTGAAG -3'
Posted On 2022-02-07