Incidental Mutation 'R9207:Axdnd1'
ID 698561
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms LOC381304, 9430070O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9207 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 156323509-156421159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 156388046 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 226 (L226P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000177824
AA Change: L324P

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: L324P

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178036
AA Change: L389P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: L389P

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000213088
AA Change: L389P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,526,623 I173S probably damaging Het
Actrt2 T A 4: 154,667,463 H72L probably benign Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Begain T C 12: 109,033,324 D507G probably damaging Het
Bsdc1 A G 4: 129,469,037 N134S probably benign Het
Ccdc39 C A 3: 33,832,557 E301* probably null Het
Cdh23 A G 10: 60,407,431 V1055A probably damaging Het
Efcab8 A G 2: 153,814,419 D591G unknown Het
Fibcd1 G A 2: 31,816,443 R459C probably damaging Het
Frem3 T G 8: 80,613,442 V788G possibly damaging Het
Ftcd A T 10: 76,587,139 I423L probably benign Het
Gad1 G A 2: 70,579,202 probably null Het
Gm8229 T C 14: 44,368,781 L156P Het
Grm7 T C 6: 111,358,913 Y762H probably damaging Het
Hectd4 T A 5: 121,295,433 V937D possibly damaging Het
Ifnz T C 4: 88,783,288 V168A probably benign Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Itgb4 G T 11: 116,007,097 G1603V probably damaging Het
Krt32 A G 11: 100,086,754 V162A possibly damaging Het
Mpped2 A G 2: 106,866,974 T265A probably benign Het
Npas3 T C 12: 54,068,035 L580P possibly damaging Het
Olfr1317 G A 2: 112,142,052 V36M probably benign Het
Olfr1463 A T 19: 13,235,036 Q262L possibly damaging Het
Olfr921 G A 9: 38,775,664 M136I possibly damaging Het
Plec A G 15: 76,173,917 L3940P probably damaging Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad54l T C 4: 116,110,018 H281R probably damaging Het
Rftn2 T A 1: 55,184,990 Q397L probably damaging Het
Rnf166 C T 8: 122,468,329 A151T probably benign Het
Setdb1 A T 3: 95,338,802 I604N possibly damaging Het
Smr2 A G 5: 88,108,867 T135A unknown Het
Snai2 C A 16: 14,707,082 H151N possibly damaging Het
Spag6l A T 16: 16,780,628 I333N probably benign Het
Spta1 A G 1: 174,211,573 T1161A probably benign Het
Sult2a1 G T 7: 13,832,702 A116E probably benign Het
Tas2r120 T A 6: 132,657,663 L236* probably null Het
Tchhl1 T A 3: 93,470,512 N174K possibly damaging Het
Tex15 T C 8: 33,575,756 L1738P probably damaging Het
Timp4 T C 6: 115,247,309 Y133C probably damaging Het
Tmem25 A G 9: 44,799,179 probably null Het
Tubd1 A T 11: 86,565,711 T399S probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Zfp110 A T 7: 12,848,558 I378L probably benign Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 splice site probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R8256:Axdnd1 UTSW 1 156330666 missense unknown
R8348:Axdnd1 UTSW 1 156418284 missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156391946 missense
R9294:Axdnd1 UTSW 1 156420347 nonsense probably null
R9741:Axdnd1 UTSW 1 156341815 missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCCACAAAACCTATGATATTC -3'
(R):5'- AATATGCCGTGGTTACCTTAGG -3'

Sequencing Primer
(F):5'- CTCTCTGAGTTTGAGGCCAGAC -3'
(R):5'- CCTTAGGAAGGGGCTTGAAG -3'
Posted On 2022-02-07