Incidental Mutation 'R9207:Tchhl1'
ID 698569
Institutional Source Beutler Lab
Gene Symbol Tchhl1
Ensembl Gene ENSMUSG00000027908
Gene Name trichohyalin-like 1
Synonyms S100a17, Thhl1
MMRRC Submission 068981-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9207 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 93376061-93379287 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93377819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 174 (N174K)
Ref Sequence ENSEMBL: ENSMUSP00000029516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029516]
AlphaFold Q9D3P1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029516
AA Change: N174K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: N174K

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-15 PFAM
low complexity region 111 124 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,979,657 (GRCm39) I173S probably damaging Het
Actrt2 T A 4: 154,751,920 (GRCm39) H72L probably benign Het
Adgrf1 A G 17: 43,621,164 (GRCm39) D467G probably benign Het
Axdnd1 A G 1: 156,215,616 (GRCm39) L226P Het
Begain T C 12: 108,999,250 (GRCm39) D507G probably damaging Het
Bsdc1 A G 4: 129,362,830 (GRCm39) N134S probably benign Het
Ccdc39 C A 3: 33,886,706 (GRCm39) E301* probably null Het
Cdh23 A G 10: 60,243,210 (GRCm39) V1055A probably damaging Het
Efcab8 A G 2: 153,656,339 (GRCm39) D591G unknown Het
Fibcd1 G A 2: 31,706,455 (GRCm39) R459C probably damaging Het
Frem3 T G 8: 81,340,071 (GRCm39) V788G possibly damaging Het
Ftcd A T 10: 76,422,973 (GRCm39) I423L probably benign Het
Gad1 G A 2: 70,409,546 (GRCm39) probably null Het
Gm8229 T C 14: 44,606,238 (GRCm39) L156P Het
Grm7 T C 6: 111,335,874 (GRCm39) Y762H probably damaging Het
Hectd4 T A 5: 121,433,496 (GRCm39) V937D possibly damaging Het
Ifnz T C 4: 88,701,525 (GRCm39) V168A probably benign Het
Irx4 C G 13: 73,416,649 (GRCm39) C348W probably damaging Het
Itgb4 G T 11: 115,897,923 (GRCm39) G1603V probably damaging Het
Krt32 A G 11: 99,977,580 (GRCm39) V162A possibly damaging Het
Mpped2 A G 2: 106,697,319 (GRCm39) T265A probably benign Het
Npas3 T C 12: 54,114,818 (GRCm39) L580P possibly damaging Het
Or4f47 G A 2: 111,972,397 (GRCm39) V36M probably benign Het
Or5b109 A T 19: 13,212,400 (GRCm39) Q262L possibly damaging Het
Or8b54 G A 9: 38,686,960 (GRCm39) M136I possibly damaging Het
Plec A G 15: 76,058,117 (GRCm39) L3940P probably damaging Het
Pum2 T C 12: 8,763,904 (GRCm39) Y283H probably damaging Het
Rad54l T C 4: 115,967,215 (GRCm39) H281R probably damaging Het
Rftn2 T A 1: 55,224,149 (GRCm39) Q397L probably damaging Het
Rnf166 C T 8: 123,195,068 (GRCm39) A151T probably benign Het
Setdb1 A T 3: 95,246,113 (GRCm39) I604N possibly damaging Het
Smr2 A G 5: 88,256,726 (GRCm39) T135A unknown Het
Snai2 C A 16: 14,524,946 (GRCm39) H151N possibly damaging Het
Spag6l A T 16: 16,598,492 (GRCm39) I333N probably benign Het
Spta1 A G 1: 174,039,139 (GRCm39) T1161A probably benign Het
Sult2a1 G T 7: 13,566,627 (GRCm39) A116E probably benign Het
Tas2r120 T A 6: 132,634,626 (GRCm39) L236* probably null Het
Tex15 T C 8: 34,065,784 (GRCm39) L1738P probably damaging Het
Timp4 T C 6: 115,224,270 (GRCm39) Y133C probably damaging Het
Tmem25 A G 9: 44,710,476 (GRCm39) probably null Het
Tubd1 A T 11: 86,456,537 (GRCm39) T399S probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Zfp110 A T 7: 12,582,485 (GRCm39) I378L probably benign Het
Other mutations in Tchhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tchhl1 APN 3 93,378,230 (GRCm39) missense probably benign 0.00
IGL00803:Tchhl1 APN 3 93,378,207 (GRCm39) missense probably benign 0.00
IGL01075:Tchhl1 APN 3 93,377,623 (GRCm39) missense probably damaging 1.00
IGL01814:Tchhl1 APN 3 93,377,656 (GRCm39) missense possibly damaging 0.53
IGL02026:Tchhl1 APN 3 93,377,862 (GRCm39) missense probably damaging 0.99
IGL02407:Tchhl1 APN 3 93,378,634 (GRCm39) missense possibly damaging 0.95
IGL03286:Tchhl1 APN 3 93,378,430 (GRCm39) missense probably benign 0.00
IGL03293:Tchhl1 APN 3 93,377,582 (GRCm39) missense probably damaging 1.00
Reef UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0371:Tchhl1 UTSW 3 93,376,884 (GRCm39) missense probably damaging 1.00
R0403:Tchhl1 UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0763:Tchhl1 UTSW 3 93,378,878 (GRCm39) missense probably benign 0.05
R1052:Tchhl1 UTSW 3 93,377,520 (GRCm39) missense probably benign 0.32
R1848:Tchhl1 UTSW 3 93,378,408 (GRCm39) missense probably damaging 1.00
R4917:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R4918:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R4945:Tchhl1 UTSW 3 93,378,883 (GRCm39) missense probably benign 0.00
R5251:Tchhl1 UTSW 3 93,377,860 (GRCm39) missense possibly damaging 0.70
R5260:Tchhl1 UTSW 3 93,378,102 (GRCm39) missense probably damaging 1.00
R5398:Tchhl1 UTSW 3 93,378,910 (GRCm39) missense probably benign 0.01
R5759:Tchhl1 UTSW 3 93,378,863 (GRCm39) missense probably damaging 1.00
R5760:Tchhl1 UTSW 3 93,378,863 (GRCm39) missense probably damaging 1.00
R5872:Tchhl1 UTSW 3 93,377,836 (GRCm39) missense probably benign 0.31
R6592:Tchhl1 UTSW 3 93,378,116 (GRCm39) missense probably damaging 0.99
R7464:Tchhl1 UTSW 3 93,377,971 (GRCm39) missense probably benign 0.01
R7653:Tchhl1 UTSW 3 93,378,451 (GRCm39) missense probably benign 0.01
R7726:Tchhl1 UTSW 3 93,379,065 (GRCm39) missense probably benign 0.07
R8487:Tchhl1 UTSW 3 93,376,869 (GRCm39) missense probably damaging 1.00
RF018:Tchhl1 UTSW 3 93,377,691 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTGGAAACATTCAGCAGG -3'
(R):5'- AGTTGGCCTCTGAATCATATGG -3'

Sequencing Primer
(F):5'- ACATTCAGCAGGTAGTAGGGGTTG -3'
(R):5'- GTGTCACTTAGCCTCCTGGATG -3'
Posted On 2022-02-07