Incidental Mutation 'R9208:Hdc'
ID 698611
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, Hdc-c, Hdc-e, L-histidine decarboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R9208 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 126593667-126619299 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126594680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 424 (N424D)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect probably benign
Transcript: ENSMUST00000028838
AA Change: N424D

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: N424D

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,529 L358F probably damaging Het
Acot6 T A 12: 84,106,584 L200Q possibly damaging Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
C87436 A G 6: 86,446,245 D267G probably benign Het
Ccdc7a T A 8: 128,746,001 I1617F possibly damaging Het
Cic T C 7: 25,288,077 F1397L probably benign Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Clock A G 5: 76,237,024 S449P probably benign Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dctn1 T C 6: 83,199,702 V1246A probably benign Het
Dennd5b T C 6: 149,101,200 E37G probably benign Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Ercc5 T C 1: 44,178,343 W949R possibly damaging Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fam83d T A 2: 158,768,546 C145S probably damaging Het
Fbln7 T A 2: 128,895,423 V386E probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm3636 T A 14: 6,741,416 R5S possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Hdac9 A G 12: 34,170,102 M897T probably benign Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lrrd1 T A 5: 3,850,995 H433Q probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mphosph9 T C 5: 124,312,791 N306D probably damaging Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Mslnl C T 17: 25,742,720 P117S possibly damaging Het
Muc16 T A 9: 18,508,537 K117M probably damaging Het
Mycbp2 T C 14: 103,295,228 N430S probably benign Het
Myl1 T C 1: 66,934,524 I8V probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nkx3-2 T A 5: 41,761,771 R291S probably damaging Het
Nr4a2 A G 2: 57,109,081 V448A probably damaging Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Olfr1259 C A 2: 89,943,381 V245L possibly damaging Het
Olfr282 C A 15: 98,437,733 A88E probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Per1 T C 11: 69,104,810 S739P possibly damaging Het
Plekhn1 A C 4: 156,222,402 V510G possibly damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Pram1 A G 17: 33,640,827 T123A probably benign Het
Ptpn23 C A 9: 110,408,033 probably null Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rxfp4 T A 3: 88,652,083 R354* probably null Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc7a14 T A 3: 31,227,210 D317V probably damaging Het
Slco5a1 A G 1: 12,989,578 probably null Het
Snx14 T A 9: 88,383,779 T768S probably benign Het
Sorbs1 T A 19: 40,365,018 probably benign Het
Stambp C T 6: 83,551,972 A364T probably damaging Het
Tgm3 T A 2: 130,023,698 I6N possibly damaging Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Treml2 A T 17: 48,307,894 R136* probably null Het
Trim46 T C 3: 89,235,159 T674A possibly damaging Het
Trmt13 T A 3: 116,582,707 Y345F possibly damaging Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Uvssa T C 5: 33,414,075 probably null Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r45 A T 7: 8,483,299 I330N probably damaging Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126601872 missense probably benign 0.00
IGL01024:Hdc APN 2 126603846 missense probably benign 0.32
IGL01393:Hdc APN 2 126594661 missense probably benign 0.28
IGL01802:Hdc APN 2 126603894 missense probably benign 0.04
IGL01958:Hdc APN 2 126594532 missense possibly damaging 0.87
IGL02193:Hdc APN 2 126601780 splice site probably benign
IGL02494:Hdc APN 2 126594121 missense probably benign
IGL02696:Hdc APN 2 126594300 missense probably damaging 1.00
IGL02874:Hdc APN 2 126601676 missense probably benign 0.21
R0453:Hdc UTSW 2 126594951 splice site probably benign
R0528:Hdc UTSW 2 126616232 missense probably benign 0.00
R1337:Hdc UTSW 2 126616276 missense probably benign
R1862:Hdc UTSW 2 126597933 missense probably benign 0.36
R1938:Hdc UTSW 2 126606397 missense possibly damaging 0.86
R1994:Hdc UTSW 2 126616187 missense probably damaging 1.00
R2230:Hdc UTSW 2 126594018 missense possibly damaging 0.65
R2257:Hdc UTSW 2 126616080 splice site probably null
R2921:Hdc UTSW 2 126593990 missense probably damaging 1.00
R2923:Hdc UTSW 2 126593990 missense probably damaging 1.00
R3620:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3621:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3914:Hdc UTSW 2 126603006 missense probably damaging 1.00
R4076:Hdc UTSW 2 126616261 missense possibly damaging 0.92
R4114:Hdc UTSW 2 126601818 missense probably benign 0.16
R4213:Hdc UTSW 2 126597866 splice site probably null
R4827:Hdc UTSW 2 126594313 missense probably benign
R4889:Hdc UTSW 2 126594133 missense probably benign 0.00
R5013:Hdc UTSW 2 126604300 missense probably benign 0.33
R5593:Hdc UTSW 2 126618584 utr 5 prime probably benign
R5604:Hdc UTSW 2 126594663 missense probably benign
R5637:Hdc UTSW 2 126616189 missense probably benign 0.02
R6211:Hdc UTSW 2 126593977 missense probably damaging 0.98
R6312:Hdc UTSW 2 126607406 missense possibly damaging 0.65
R7730:Hdc UTSW 2 126594082 missense possibly damaging 0.51
R7889:Hdc UTSW 2 126616210 missense probably damaging 1.00
R8328:Hdc UTSW 2 126601883 missense probably damaging 1.00
R8482:Hdc UTSW 2 126594205 missense probably benign
R8517:Hdc UTSW 2 126597970 critical splice acceptor site probably null
R9136:Hdc UTSW 2 126597866 splice site probably null
R9139:Hdc UTSW 2 126597917 missense probably damaging 1.00
R9515:Hdc UTSW 2 126616229 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAGGTTAGCAGCCTCTTGG -3'
(R):5'- ATCTCTGGTCAGAAGCGACC -3'

Sequencing Primer
(F):5'- GATGAGGTGCCAATCTCTCAG -3'
(R):5'- AATTCCTGCTAAGAGGCACCTTGG -3'
Posted On 2022-02-07