Incidental Mutation 'R9208:Fam83d'
ID 698614
Institutional Source Beutler Lab
Gene Symbol Fam83d
Ensembl Gene ENSMUSG00000027654
Gene Name family with sequence similarity 83, member D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9208 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 158768093-158786637 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 158768546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 145 (C145S)
Ref Sequence ENSEMBL: ENSMUSP00000029183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029183] [ENSMUST00000045503] [ENSMUST00000052927] [ENSMUST00000103116] [ENSMUST00000145073]
AlphaFold Q9D7I8
Predicted Effect probably damaging
Transcript: ENSMUST00000029183
AA Change: C145S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029183
Gene: ENSMUSG00000027654
AA Change: C145S

DomainStartEndE-ValueType
Pfam:DUF1669 17 293 1.4e-100 PFAM
Pfam:PLDc_2 149 288 3.1e-12 PFAM
low complexity region 345 359 N/A INTRINSIC
low complexity region 458 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045503
SMART Domains Protein: ENSMUSP00000039540
Gene: ENSMUSG00000037754

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052927
SMART Domains Protein: ENSMUSP00000062615
Gene: ENSMUSG00000037754

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103116
SMART Domains Protein: ENSMUSP00000099405
Gene: ENSMUSG00000037754

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145073
SMART Domains Protein: ENSMUSP00000117310
Gene: ENSMUSG00000037754

DomainStartEndE-ValueType
ANK 9 38 5.69e2 SMART
ANK 42 71 5.04e-6 SMART
ANK 75 104 1.76e-5 SMART
Blast:ANK 149 190 5e-18 BLAST
low complexity region 201 214 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Meta Mutation Damage Score 0.7971 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,529 L358F probably damaging Het
Acot6 T A 12: 84,106,584 L200Q possibly damaging Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
C87436 A G 6: 86,446,245 D267G probably benign Het
Ccdc7a T A 8: 128,746,001 I1617F possibly damaging Het
Cic T C 7: 25,288,077 F1397L probably benign Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Clock A G 5: 76,237,024 S449P probably benign Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dctn1 T C 6: 83,199,702 V1246A probably benign Het
Dennd5b T C 6: 149,101,200 E37G probably benign Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Ercc5 T C 1: 44,178,343 W949R possibly damaging Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fbln7 T A 2: 128,895,423 V386E probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm3636 T A 14: 6,741,416 R5S possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Hdac9 A G 12: 34,170,102 M897T probably benign Het
Hdc T C 2: 126,594,680 N424D probably benign Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lrrd1 T A 5: 3,850,995 H433Q probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mphosph9 T C 5: 124,312,791 N306D probably damaging Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Mslnl C T 17: 25,742,720 P117S possibly damaging Het
Muc16 T A 9: 18,508,537 K117M probably damaging Het
Mycbp2 T C 14: 103,295,228 N430S probably benign Het
Myl1 T C 1: 66,934,524 I8V probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nkx3-2 T A 5: 41,761,771 R291S probably damaging Het
Nr4a2 A G 2: 57,109,081 V448A probably damaging Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Olfr1259 C A 2: 89,943,381 V245L possibly damaging Het
Olfr282 C A 15: 98,437,733 A88E probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Per1 T C 11: 69,104,810 S739P possibly damaging Het
Plekhn1 A C 4: 156,222,402 V510G possibly damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Pram1 A G 17: 33,640,827 T123A probably benign Het
Ptpn23 C A 9: 110,408,033 probably null Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rxfp4 T A 3: 88,652,083 R354* probably null Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc7a14 T A 3: 31,227,210 D317V probably damaging Het
Slco5a1 A G 1: 12,989,578 probably null Het
Snx14 T A 9: 88,383,779 T768S probably benign Het
Sorbs1 T A 19: 40,365,018 probably benign Het
Stambp C T 6: 83,551,972 A364T probably damaging Het
Tgm3 T A 2: 130,023,698 I6N possibly damaging Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Treml2 A T 17: 48,307,894 R136* probably null Het
Trim46 T C 3: 89,235,159 T674A possibly damaging Het
Trmt13 T A 3: 116,582,707 Y345F possibly damaging Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Uvssa T C 5: 33,414,075 probably null Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r45 A T 7: 8,483,299 I330N probably damaging Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Other mutations in Fam83d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Fam83d APN 2 158785873 missense probably benign 0.37
IGL02420:Fam83d APN 2 158785735 missense probably benign 0.00
R0277:Fam83d UTSW 2 158785547 missense probably benign 0.05
R0323:Fam83d UTSW 2 158785547 missense probably benign 0.05
R0349:Fam83d UTSW 2 158779848 missense possibly damaging 0.95
R0571:Fam83d UTSW 2 158785691 nonsense probably null
R0799:Fam83d UTSW 2 158779888 missense probably damaging 1.00
R1164:Fam83d UTSW 2 158783250 missense probably damaging 1.00
R1168:Fam83d UTSW 2 158768523 missense probably benign 0.01
R1186:Fam83d UTSW 2 158785174 missense probably damaging 1.00
R1816:Fam83d UTSW 2 158768150 missense possibly damaging 0.55
R2896:Fam83d UTSW 2 158785978 missense probably damaging 1.00
R4500:Fam83d UTSW 2 158785267 missense probably benign 0.10
R4597:Fam83d UTSW 2 158785222 missense possibly damaging 0.94
R5416:Fam83d UTSW 2 158785632 missense possibly damaging 0.75
R5866:Fam83d UTSW 2 158779830 splice site probably null
R6328:Fam83d UTSW 2 158785176 missense probably damaging 1.00
R6364:Fam83d UTSW 2 158783259 critical splice donor site probably null
R7031:Fam83d UTSW 2 158785307 missense probably benign 0.01
R8721:Fam83d UTSW 2 158785602 missense probably benign 0.33
Z1177:Fam83d UTSW 2 158785188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGGCTCCTCTCACGAATG -3'
(R):5'- TTACTTAGCTCCTGAAAGTGAGACC -3'

Sequencing Primer
(F):5'- GAATGCTCGTCGGGCAC -3'
(R):5'- GCTCCTGAAAGTGAGACCTAATGTC -3'
Posted On 2022-02-07