Incidental Mutation 'R9208:Resf1'
ID 698638
Institutional Source Beutler Lab
Gene Symbol Resf1
Ensembl Gene ENSMUSG00000032712
Gene Name retroelement silencing factor 1
Synonyms 2810474O19Rik, GET
MMRRC Submission 068982-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9208 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 149210912-149237161 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 149228027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 358 (L358F)
Ref Sequence ENSEMBL: ENSMUSP00000041180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
AlphaFold Q5DTW7
Predicted Effect probably damaging
Transcript: ENSMUST00000046689
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100765
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably damaging
Transcript: ENSMUST00000130664
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably damaging
Transcript: ENSMUST00000189837
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189932
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190785
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Meta Mutation Damage Score 0.3617 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (65/66)
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 T A 12: 84,153,358 (GRCm39) L200Q possibly damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
C87436 A G 6: 86,423,227 (GRCm39) D267G probably benign Het
Ccdc7a T A 8: 129,472,482 (GRCm39) I1617F possibly damaging Het
Cic T C 7: 24,987,502 (GRCm39) F1397L probably benign Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Clock A G 5: 76,384,871 (GRCm39) S449P probably benign Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dctn1 T C 6: 83,176,684 (GRCm39) V1246A probably benign Het
Dennd5b T C 6: 149,002,698 (GRCm39) E37G probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Ercc5 T C 1: 44,217,503 (GRCm39) W949R possibly damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fam83d T A 2: 158,610,466 (GRCm39) C145S probably damaging Het
Fbln7 T A 2: 128,737,343 (GRCm39) V386E probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm3636 T A 14: 17,955,001 (GRCm39) R5S possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Hdac9 A G 12: 34,220,101 (GRCm39) M897T probably benign Het
Hdc T C 2: 126,436,600 (GRCm39) N424D probably benign Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lrrd1 T A 5: 3,900,995 (GRCm39) H433Q probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mphosph9 T C 5: 124,450,854 (GRCm39) N306D probably damaging Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Mslnl C T 17: 25,961,694 (GRCm39) P117S possibly damaging Het
Muc16 T A 9: 18,419,833 (GRCm39) K117M probably damaging Het
Mycbp2 T C 14: 103,532,664 (GRCm39) N430S probably benign Het
Myl1 T C 1: 66,973,683 (GRCm39) I8V probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nkx3-2 T A 5: 41,919,114 (GRCm39) R291S probably damaging Het
Nr4a2 A G 2: 56,999,093 (GRCm39) V448A probably damaging Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Or4c12 C A 2: 89,773,725 (GRCm39) V245L possibly damaging Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Or8s10 C A 15: 98,335,614 (GRCm39) A88E probably benign Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Per1 T C 11: 68,995,636 (GRCm39) S739P possibly damaging Het
Plekhn1 A C 4: 156,306,859 (GRCm39) V510G possibly damaging Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Pram1 A G 17: 33,859,801 (GRCm39) T123A probably benign Het
Ptpn23 C A 9: 110,237,101 (GRCm39) probably null Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Rxfp4 T A 3: 88,559,390 (GRCm39) R354* probably null Het
Serpinb5 A G 1: 106,803,853 (GRCm39) T180A probably damaging Het
Slc7a14 T A 3: 31,281,359 (GRCm39) D317V probably damaging Het
Slco5a1 A G 1: 13,059,802 (GRCm39) probably null Het
Snx14 T A 9: 88,265,832 (GRCm39) T768S probably benign Het
Sorbs1 T A 19: 40,353,462 (GRCm39) probably benign Het
Stambp C T 6: 83,528,954 (GRCm39) A364T probably damaging Het
Tgm3 T A 2: 129,865,618 (GRCm39) I6N possibly damaging Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Treml2 A T 17: 48,614,922 (GRCm39) R136* probably null Het
Trim46 T C 3: 89,142,466 (GRCm39) T674A possibly damaging Het
Trmt13 T A 3: 116,376,356 (GRCm39) Y345F possibly damaging Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Uvssa T C 5: 33,571,419 (GRCm39) probably null Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Vmn2r45 A T 7: 8,486,298 (GRCm39) I330N probably damaging Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Other mutations in Resf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Resf1 APN 6 149,236,248 (GRCm39) utr 3 prime probably benign
IGL01401:Resf1 APN 6 149,228,394 (GRCm39) missense probably damaging 0.98
IGL01461:Resf1 APN 6 149,233,013 (GRCm39) unclassified probably benign
IGL01610:Resf1 APN 6 149,230,449 (GRCm39) missense probably benign 0.01
IGL02873:Resf1 APN 6 149,228,538 (GRCm39) missense probably damaging 1.00
IGL03202:Resf1 APN 6 149,227,937 (GRCm39) missense probably benign 0.08
grand_junction UTSW 6 149,229,376 (GRCm39) missense probably damaging 0.98
grand_marais UTSW 6 149,227,958 (GRCm39) nonsense probably null
3-1:Resf1 UTSW 6 149,229,227 (GRCm39) missense probably damaging 0.98
B6584:Resf1 UTSW 6 149,230,844 (GRCm39) missense probably damaging 0.96
PIT4280001:Resf1 UTSW 6 149,227,023 (GRCm39) missense probably benign 0.23
R0053:Resf1 UTSW 6 149,229,088 (GRCm39) missense probably benign 0.00
R0053:Resf1 UTSW 6 149,229,088 (GRCm39) missense probably benign 0.00
R0243:Resf1 UTSW 6 149,227,739 (GRCm39) missense probably damaging 1.00
R0620:Resf1 UTSW 6 149,229,873 (GRCm39) missense probably damaging 1.00
R0633:Resf1 UTSW 6 149,227,199 (GRCm39) missense probably benign 0.00
R0727:Resf1 UTSW 6 149,227,320 (GRCm39) missense possibly damaging 0.94
R0904:Resf1 UTSW 6 149,229,767 (GRCm39) missense probably damaging 0.99
R1221:Resf1 UTSW 6 149,227,719 (GRCm39) missense probably benign 0.24
R1282:Resf1 UTSW 6 149,230,670 (GRCm39) nonsense probably null
R1435:Resf1 UTSW 6 149,227,580 (GRCm39) missense probably benign 0.04
R1452:Resf1 UTSW 6 149,228,130 (GRCm39) missense probably damaging 1.00
R1587:Resf1 UTSW 6 149,228,018 (GRCm39) missense probably damaging 1.00
R1912:Resf1 UTSW 6 149,230,342 (GRCm39) missense possibly damaging 0.80
R1926:Resf1 UTSW 6 149,230,902 (GRCm39) missense probably benign 0.39
R1978:Resf1 UTSW 6 149,227,930 (GRCm39) missense probably benign 0.12
R2035:Resf1 UTSW 6 149,230,724 (GRCm39) missense possibly damaging 0.91
R2136:Resf1 UTSW 6 149,230,320 (GRCm39) missense probably benign 0.01
R2333:Resf1 UTSW 6 149,229,009 (GRCm39) missense probably damaging 1.00
R2360:Resf1 UTSW 6 149,236,145 (GRCm39) missense probably benign 0.05
R3027:Resf1 UTSW 6 149,230,533 (GRCm39) missense probably benign 0.02
R3121:Resf1 UTSW 6 149,230,741 (GRCm39) nonsense probably null
R3707:Resf1 UTSW 6 149,230,611 (GRCm39) missense probably damaging 0.98
R4204:Resf1 UTSW 6 149,231,042 (GRCm39) nonsense probably null
R4247:Resf1 UTSW 6 149,227,041 (GRCm39) missense possibly damaging 0.87
R4249:Resf1 UTSW 6 149,227,041 (GRCm39) missense possibly damaging 0.87
R4304:Resf1 UTSW 6 149,227,736 (GRCm39) nonsense probably null
R4385:Resf1 UTSW 6 149,227,706 (GRCm39) missense possibly damaging 0.93
R4702:Resf1 UTSW 6 149,230,901 (GRCm39) missense probably benign 0.05
R4747:Resf1 UTSW 6 149,228,392 (GRCm39) missense probably damaging 0.96
R4912:Resf1 UTSW 6 149,230,887 (GRCm39) missense probably damaging 1.00
R4913:Resf1 UTSW 6 149,230,887 (GRCm39) missense probably damaging 1.00
R4965:Resf1 UTSW 6 149,229,896 (GRCm39) nonsense probably null
R4971:Resf1 UTSW 6 149,227,097 (GRCm39) unclassified probably benign
R5077:Resf1 UTSW 6 149,227,528 (GRCm39) missense probably benign 0.14
R5213:Resf1 UTSW 6 149,227,551 (GRCm39) missense possibly damaging 0.77
R5382:Resf1 UTSW 6 149,227,958 (GRCm39) nonsense probably null
R5418:Resf1 UTSW 6 149,227,634 (GRCm39) missense probably damaging 1.00
R5452:Resf1 UTSW 6 149,230,611 (GRCm39) nonsense probably null
R5498:Resf1 UTSW 6 149,229,738 (GRCm39) missense probably damaging 0.99
R5673:Resf1 UTSW 6 149,229,491 (GRCm39) nonsense probably null
R5690:Resf1 UTSW 6 149,229,735 (GRCm39) missense possibly damaging 0.95
R5916:Resf1 UTSW 6 149,228,076 (GRCm39) missense probably damaging 0.99
R5917:Resf1 UTSW 6 149,236,179 (GRCm39) missense probably damaging 0.98
R6160:Resf1 UTSW 6 149,233,005 (GRCm39) critical splice donor site probably null
R6280:Resf1 UTSW 6 149,228,555 (GRCm39) missense probably damaging 1.00
R6326:Resf1 UTSW 6 149,230,493 (GRCm39) missense probably damaging 0.96
R6396:Resf1 UTSW 6 149,229,417 (GRCm39) missense probably damaging 1.00
R6702:Resf1 UTSW 6 149,229,376 (GRCm39) missense probably damaging 0.98
R6972:Resf1 UTSW 6 149,227,607 (GRCm39) missense probably damaging 0.99
R7127:Resf1 UTSW 6 149,229,443 (GRCm39) missense possibly damaging 0.95
R7168:Resf1 UTSW 6 149,229,341 (GRCm39) missense probably benign
R7316:Resf1 UTSW 6 149,228,136 (GRCm39) missense probably damaging 0.99
R7586:Resf1 UTSW 6 149,228,291 (GRCm39) missense possibly damaging 0.76
R7719:Resf1 UTSW 6 149,228,853 (GRCm39) missense probably benign
R7751:Resf1 UTSW 6 149,226,936 (GRCm39) start gained probably benign
R8013:Resf1 UTSW 6 149,230,368 (GRCm39) missense probably damaging 0.96
R8358:Resf1 UTSW 6 149,228,076 (GRCm39) missense probably damaging 0.99
R8393:Resf1 UTSW 6 149,229,998 (GRCm39) missense possibly damaging 0.56
R8968:Resf1 UTSW 6 149,228,664 (GRCm39) missense probably damaging 0.96
R8977:Resf1 UTSW 6 149,229,906 (GRCm39) missense probably damaging 0.99
R8981:Resf1 UTSW 6 149,227,997 (GRCm39) missense probably benign 0.06
R9106:Resf1 UTSW 6 149,230,368 (GRCm39) missense possibly damaging 0.77
R9294:Resf1 UTSW 6 149,227,930 (GRCm39) missense probably benign 0.12
R9352:Resf1 UTSW 6 149,236,180 (GRCm39) missense probably damaging 1.00
R9361:Resf1 UTSW 6 149,228,132 (GRCm39) missense possibly damaging 0.70
R9513:Resf1 UTSW 6 149,229,793 (GRCm39) nonsense probably null
R9566:Resf1 UTSW 6 149,227,352 (GRCm39) missense possibly damaging 0.91
R9623:Resf1 UTSW 6 149,226,965 (GRCm39) missense possibly damaging 0.91
R9689:Resf1 UTSW 6 149,229,766 (GRCm39) nonsense probably null
R9752:Resf1 UTSW 6 149,228,068 (GRCm39) missense probably benign 0.07
R9794:Resf1 UTSW 6 149,228,239 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGTTTCTAAACACTTGCC -3'
(R):5'- GTTTTACTACAACCAGCTGCCATC -3'

Sequencing Primer
(F):5'- CCTATGGAAGTTCCTCAGAGTTCAG -3'
(R):5'- TTACTACAACCAGCTGCCATCAAAAG -3'
Posted On 2022-02-07