Incidental Mutation 'R9208:2810474O19Rik'
ID 698638
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene Name RIKEN cDNA 2810474O19 gene
Synonyms GET
MMRRC Submission
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9208 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 149309414-149335663 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 149326529 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 358 (L358F)
Ref Sequence ENSEMBL: ENSMUSP00000041180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
AlphaFold Q5DTW7
Predicted Effect probably damaging
Transcript: ENSMUST00000046689
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100765
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably damaging
Transcript: ENSMUST00000130664
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably damaging
Transcript: ENSMUST00000189837
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189932
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190785
AA Change: L358F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: L358F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Meta Mutation Damage Score 0.3617 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (65/66)
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 T A 12: 84,106,584 L200Q possibly damaging Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
C87436 A G 6: 86,446,245 D267G probably benign Het
Ccdc7a T A 8: 128,746,001 I1617F possibly damaging Het
Cic T C 7: 25,288,077 F1397L probably benign Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Clock A G 5: 76,237,024 S449P probably benign Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dctn1 T C 6: 83,199,702 V1246A probably benign Het
Dennd5b T C 6: 149,101,200 E37G probably benign Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Ercc5 T C 1: 44,178,343 W949R possibly damaging Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fam83d T A 2: 158,768,546 C145S probably damaging Het
Fbln7 T A 2: 128,895,423 V386E probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm3636 T A 14: 6,741,416 R5S possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Hdac9 A G 12: 34,170,102 M897T probably benign Het
Hdc T C 2: 126,594,680 N424D probably benign Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lrrd1 T A 5: 3,850,995 H433Q probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mphosph9 T C 5: 124,312,791 N306D probably damaging Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Mslnl C T 17: 25,742,720 P117S possibly damaging Het
Muc16 T A 9: 18,508,537 K117M probably damaging Het
Mycbp2 T C 14: 103,295,228 N430S probably benign Het
Myl1 T C 1: 66,934,524 I8V probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nkx3-2 T A 5: 41,761,771 R291S probably damaging Het
Nr4a2 A G 2: 57,109,081 V448A probably damaging Het
Nrip1 T C 16: 76,292,728 E647G possibly damaging Het
Olfr1259 C A 2: 89,943,381 V245L possibly damaging Het
Olfr282 C A 15: 98,437,733 A88E probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Per1 T C 11: 69,104,810 S739P possibly damaging Het
Plekhn1 A C 4: 156,222,402 V510G possibly damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Pram1 A G 17: 33,640,827 T123A probably benign Het
Ptpn23 C A 9: 110,408,033 probably null Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rxfp4 T A 3: 88,652,083 R354* probably null Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc7a14 T A 3: 31,227,210 D317V probably damaging Het
Slco5a1 A G 1: 12,989,578 probably null Het
Snx14 T A 9: 88,383,779 T768S probably benign Het
Sorbs1 T A 19: 40,365,018 probably benign Het
Stambp C T 6: 83,551,972 A364T probably damaging Het
Tgm3 T A 2: 130,023,698 I6N possibly damaging Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Treml2 A T 17: 48,307,894 R136* probably null Het
Trim46 T C 3: 89,235,159 T674A possibly damaging Het
Trmt13 T A 3: 116,582,707 Y345F possibly damaging Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Uvssa T C 5: 33,414,075 probably null Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r45 A T 7: 8,483,299 I330N probably damaging Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably benign 0.12
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
R7586:2810474O19Rik UTSW 6 149326793 missense possibly damaging 0.76
R7719:2810474O19Rik UTSW 6 149327355 missense probably benign
R7751:2810474O19Rik UTSW 6 149325438 start gained probably benign
R8013:2810474O19Rik UTSW 6 149328870 missense probably damaging 0.96
R8358:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R8393:2810474O19Rik UTSW 6 149328500 missense possibly damaging 0.56
R8968:2810474O19Rik UTSW 6 149327166 missense probably damaging 0.96
R8977:2810474O19Rik UTSW 6 149328408 missense probably damaging 0.99
R8981:2810474O19Rik UTSW 6 149326499 missense probably benign 0.06
R9106:2810474O19Rik UTSW 6 149328870 missense possibly damaging 0.77
R9294:2810474O19Rik UTSW 6 149326432 missense probably benign 0.12
R9352:2810474O19Rik UTSW 6 149334682 missense probably damaging 1.00
R9361:2810474O19Rik UTSW 6 149326634 missense possibly damaging 0.70
R9513:2810474O19Rik UTSW 6 149328295 nonsense probably null
R9566:2810474O19Rik UTSW 6 149325854 missense possibly damaging 0.91
R9623:2810474O19Rik UTSW 6 149325467 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCCTGTTTCTAAACACTTGCC -3'
(R):5'- GTTTTACTACAACCAGCTGCCATC -3'

Sequencing Primer
(F):5'- CCTATGGAAGTTCCTCAGAGTTCAG -3'
(R):5'- TTACTACAACCAGCTGCCATCAAAAG -3'
Posted On 2022-02-07