Incidental Mutation 'R9208:Muc16'
ID 698644
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009, Gm21044
MMRRC Submission 068982-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.219) question?
Stock # R9208 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18406751-18585826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18419833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 117 (K117M)
Ref Sequence ENSEMBL: ENSMUSP00000034653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]
AlphaFold no structure available at present
PDB Structure Solution structure of the SEA domain from murine hypothetical protein homologous to human mucin 16 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034653
AA Change: K117M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564
AA Change: K117M

DomainStartEndE-ValueType
Pfam:SEA 71 174 9.6e-30 PFAM
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000208663
AA Change: K8337M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 T A 12: 84,153,358 (GRCm39) L200Q possibly damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
C87436 A G 6: 86,423,227 (GRCm39) D267G probably benign Het
Ccdc7a T A 8: 129,472,482 (GRCm39) I1617F possibly damaging Het
Cic T C 7: 24,987,502 (GRCm39) F1397L probably benign Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Clock A G 5: 76,384,871 (GRCm39) S449P probably benign Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dctn1 T C 6: 83,176,684 (GRCm39) V1246A probably benign Het
Dennd5b T C 6: 149,002,698 (GRCm39) E37G probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Ercc5 T C 1: 44,217,503 (GRCm39) W949R possibly damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fam83d T A 2: 158,610,466 (GRCm39) C145S probably damaging Het
Fbln7 T A 2: 128,737,343 (GRCm39) V386E probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm3636 T A 14: 17,955,001 (GRCm39) R5S possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Hdac9 A G 12: 34,220,101 (GRCm39) M897T probably benign Het
Hdc T C 2: 126,436,600 (GRCm39) N424D probably benign Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lrrd1 T A 5: 3,900,995 (GRCm39) H433Q probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mphosph9 T C 5: 124,450,854 (GRCm39) N306D probably damaging Het
Mpp7 T C 18: 7,403,327 (GRCm39) R328G probably benign Het
Mslnl C T 17: 25,961,694 (GRCm39) P117S possibly damaging Het
Mycbp2 T C 14: 103,532,664 (GRCm39) N430S probably benign Het
Myl1 T C 1: 66,973,683 (GRCm39) I8V probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nkx3-2 T A 5: 41,919,114 (GRCm39) R291S probably damaging Het
Nr4a2 A G 2: 56,999,093 (GRCm39) V448A probably damaging Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Or4c12 C A 2: 89,773,725 (GRCm39) V245L possibly damaging Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Or8s10 C A 15: 98,335,614 (GRCm39) A88E probably benign Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Per1 T C 11: 68,995,636 (GRCm39) S739P possibly damaging Het
Plekhn1 A C 4: 156,306,859 (GRCm39) V510G possibly damaging Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Pram1 A G 17: 33,859,801 (GRCm39) T123A probably benign Het
Ptpn23 C A 9: 110,237,101 (GRCm39) probably null Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Resf1 C T 6: 149,228,027 (GRCm39) L358F probably damaging Het
Rxfp4 T A 3: 88,559,390 (GRCm39) R354* probably null Het
Serpinb5 A G 1: 106,803,853 (GRCm39) T180A probably damaging Het
Slc7a14 T A 3: 31,281,359 (GRCm39) D317V probably damaging Het
Slco5a1 A G 1: 13,059,802 (GRCm39) probably null Het
Snx14 T A 9: 88,265,832 (GRCm39) T768S probably benign Het
Sorbs1 T A 19: 40,353,462 (GRCm39) probably benign Het
Stambp C T 6: 83,528,954 (GRCm39) A364T probably damaging Het
Tgm3 T A 2: 129,865,618 (GRCm39) I6N possibly damaging Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Treml2 A T 17: 48,614,922 (GRCm39) R136* probably null Het
Trim46 T C 3: 89,142,466 (GRCm39) T674A possibly damaging Het
Trmt13 T A 3: 116,376,356 (GRCm39) Y345F possibly damaging Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Uvssa T C 5: 33,571,419 (GRCm39) probably null Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Vmn2r45 A T 7: 8,486,298 (GRCm39) I330N probably damaging Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18,419,803 (GRCm39) missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18,406,839 (GRCm39) missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18,409,996 (GRCm39) missense probably damaging 0.99
IGL02553:Muc16 APN 9 18,409,849 (GRCm39) critical splice donor site probably null
Brimming UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7038_muc16_859 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
Runneymeade UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
slimey UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
viscous UTSW 9 18,556,028 (GRCm39) missense unknown
R0400:Muc16 UTSW 9 18,421,830 (GRCm39) missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18,421,773 (GRCm39) missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18,408,729 (GRCm39) missense probably damaging 1.00
R3196:Muc16 UTSW 9 18,409,126 (GRCm39) missense probably damaging 1.00
R5982:Muc16 UTSW 9 18,558,442 (GRCm39) missense unknown
R5990:Muc16 UTSW 9 18,570,539 (GRCm39) missense unknown
R6024:Muc16 UTSW 9 18,557,967 (GRCm39) missense unknown
R6026:Muc16 UTSW 9 18,571,154 (GRCm39) missense unknown
R6028:Muc16 UTSW 9 18,568,472 (GRCm39) missense unknown
R6083:Muc16 UTSW 9 18,568,508 (GRCm39) missense unknown
R6089:Muc16 UTSW 9 18,554,548 (GRCm39) missense unknown
R6109:Muc16 UTSW 9 18,566,655 (GRCm39) missense unknown
R6127:Muc16 UTSW 9 18,569,174 (GRCm39) missense unknown
R6130:Muc16 UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
R6146:Muc16 UTSW 9 18,409,093 (GRCm39) missense probably damaging 0.98
R6161:Muc16 UTSW 9 18,559,114 (GRCm39) missense unknown
R6164:Muc16 UTSW 9 18,469,675 (GRCm39) missense probably damaging 1.00
R6185:Muc16 UTSW 9 18,565,769 (GRCm39) missense unknown
R6192:Muc16 UTSW 9 18,569,985 (GRCm39) missense unknown
R6217:Muc16 UTSW 9 18,566,742 (GRCm39) missense unknown
R6232:Muc16 UTSW 9 18,568,294 (GRCm39) missense unknown
R6246:Muc16 UTSW 9 18,488,363 (GRCm39) splice site probably null
R6255:Muc16 UTSW 9 18,566,895 (GRCm39) missense unknown
R6280:Muc16 UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
R6286:Muc16 UTSW 9 18,555,685 (GRCm39) missense unknown
R6287:Muc16 UTSW 9 18,570,330 (GRCm39) missense unknown
R6307:Muc16 UTSW 9 18,558,884 (GRCm39) missense unknown
R6310:Muc16 UTSW 9 18,553,246 (GRCm39) missense probably benign 0.00
R6316:Muc16 UTSW 9 18,553,115 (GRCm39) missense probably benign 0.01
R6335:Muc16 UTSW 9 18,572,004 (GRCm39) missense unknown
R6345:Muc16 UTSW 9 18,566,222 (GRCm39) missense unknown
R6349:Muc16 UTSW 9 18,568,625 (GRCm39) missense unknown
R6366:Muc16 UTSW 9 18,557,340 (GRCm39) missense unknown
R6393:Muc16 UTSW 9 18,558,695 (GRCm39) nonsense probably null
R6440:Muc16 UTSW 9 18,552,655 (GRCm39) missense probably benign 0.01
R6458:Muc16 UTSW 9 18,553,017 (GRCm39) missense probably benign 0.01
R6460:Muc16 UTSW 9 18,551,812 (GRCm39) missense probably benign 0.01
R6481:Muc16 UTSW 9 18,461,973 (GRCm39) critical splice donor site probably null
R6539:Muc16 UTSW 9 18,548,621 (GRCm39) missense probably benign 0.25
R6551:Muc16 UTSW 9 18,473,858 (GRCm39) missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18,478,011 (GRCm39) missense probably benign 0.18
R6601:Muc16 UTSW 9 18,548,866 (GRCm39) missense probably benign 0.10
R6602:Muc16 UTSW 9 18,520,772 (GRCm39) splice site probably null
R6615:Muc16 UTSW 9 18,558,484 (GRCm39) missense unknown
R6625:Muc16 UTSW 9 18,571,574 (GRCm39) missense unknown
R6668:Muc16 UTSW 9 18,551,681 (GRCm39) missense probably benign 0.03
R6697:Muc16 UTSW 9 18,552,587 (GRCm39) missense probably benign 0.01
R6710:Muc16 UTSW 9 18,553,366 (GRCm39) missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18,477,986 (GRCm39) critical splice donor site probably null
R6789:Muc16 UTSW 9 18,471,282 (GRCm39) missense probably benign 0.40
R6806:Muc16 UTSW 9 18,449,206 (GRCm39) critical splice donor site probably null
R6874:Muc16 UTSW 9 18,570,065 (GRCm39) nonsense probably null
R6894:Muc16 UTSW 9 18,406,872 (GRCm39) missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18,553,959 (GRCm39) missense unknown
R6919:Muc16 UTSW 9 18,571,595 (GRCm39) missense unknown
R6939:Muc16 UTSW 9 18,549,833 (GRCm39) missense probably benign 0.04
R6953:Muc16 UTSW 9 18,551,825 (GRCm39) missense probably benign 0.01
R6956:Muc16 UTSW 9 18,556,322 (GRCm39) missense unknown
R6977:Muc16 UTSW 9 18,556,633 (GRCm39) missense unknown
R6996:Muc16 UTSW 9 18,557,193 (GRCm39) missense unknown
R7011:Muc16 UTSW 9 18,548,839 (GRCm39) missense probably benign 0.10
R7011:Muc16 UTSW 9 18,548,747 (GRCm39) missense probably benign 0.26
R7012:Muc16 UTSW 9 18,406,914 (GRCm39) critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18,569,532 (GRCm39) missense unknown
R7021:Muc16 UTSW 9 18,462,127 (GRCm39) splice site probably null
R7021:Muc16 UTSW 9 18,466,215 (GRCm39) missense unknown
R7038:Muc16 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
R7057:Muc16 UTSW 9 18,557,375 (GRCm39) missense unknown
R7058:Muc16 UTSW 9 18,551,051 (GRCm39) missense probably benign 0.10
R7066:Muc16 UTSW 9 18,569,317 (GRCm39) missense unknown
R7067:Muc16 UTSW 9 18,569,547 (GRCm39) missense unknown
R7070:Muc16 UTSW 9 18,557,219 (GRCm39) nonsense probably null
R7074:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7085:Muc16 UTSW 9 18,556,145 (GRCm39) missense unknown
R7088:Muc16 UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7107:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R7108:Muc16 UTSW 9 18,566,529 (GRCm39) missense unknown
R7126:Muc16 UTSW 9 18,552,512 (GRCm39) missense probably benign 0.01
R7128:Muc16 UTSW 9 18,554,300 (GRCm39) missense unknown
R7145:Muc16 UTSW 9 18,566,876 (GRCm39) missense unknown
R7179:Muc16 UTSW 9 18,553,304 (GRCm39) missense probably benign 0.00
R7194:Muc16 UTSW 9 18,585,750 (GRCm39) missense unknown
R7211:Muc16 UTSW 9 18,409,866 (GRCm39) missense probably damaging 1.00
R7213:Muc16 UTSW 9 18,552,712 (GRCm39) missense probably benign 0.01
R7217:Muc16 UTSW 9 18,555,372 (GRCm39) nonsense probably null
R7221:Muc16 UTSW 9 18,553,495 (GRCm39) missense probably benign 0.04
R7265:Muc16 UTSW 9 18,567,768 (GRCm39) missense unknown
R7326:Muc16 UTSW 9 18,496,309 (GRCm39) missense probably benign 0.03
R7359:Muc16 UTSW 9 18,554,316 (GRCm39) missense unknown
R7387:Muc16 UTSW 9 18,553,016 (GRCm39) missense probably benign 0.01
R7391:Muc16 UTSW 9 18,550,832 (GRCm39) missense probably benign 0.04
R7398:Muc16 UTSW 9 18,549,038 (GRCm39) missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18,553,258 (GRCm39) missense probably benign 0.01
R7431:Muc16 UTSW 9 18,519,289 (GRCm39) missense
R7484:Muc16 UTSW 9 18,558,064 (GRCm39) missense unknown
R7487:Muc16 UTSW 9 18,496,095 (GRCm39) missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18,556,385 (GRCm39) missense unknown
R7515:Muc16 UTSW 9 18,550,958 (GRCm39) missense probably benign 0.00
R7537:Muc16 UTSW 9 18,549,431 (GRCm39) missense probably benign 0.06
R7538:Muc16 UTSW 9 18,566,747 (GRCm39) missense unknown
R7538:Muc16 UTSW 9 18,553,427 (GRCm39) missense probably benign 0.10
R7543:Muc16 UTSW 9 18,556,028 (GRCm39) missense unknown
R7566:Muc16 UTSW 9 18,549,925 (GRCm39) missense probably benign 0.00
R7581:Muc16 UTSW 9 18,556,910 (GRCm39) missense unknown
R7594:Muc16 UTSW 9 18,556,358 (GRCm39) missense unknown
R7629:Muc16 UTSW 9 18,478,081 (GRCm39) missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18,519,018 (GRCm39) missense probably benign 0.08
R7666:Muc16 UTSW 9 18,469,723 (GRCm39) missense probably damaging 1.00
R7703:Muc16 UTSW 9 18,516,578 (GRCm39) missense
R7727:Muc16 UTSW 9 18,571,538 (GRCm39) missense unknown
R7743:Muc16 UTSW 9 18,568,773 (GRCm39) missense unknown
R7744:Muc16 UTSW 9 18,496,392 (GRCm39) critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18,491,870 (GRCm39) missense probably damaging 1.00
R7769:Muc16 UTSW 9 18,571,803 (GRCm39) missense unknown
R7805:Muc16 UTSW 9 18,549,789 (GRCm39) missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18,506,519 (GRCm39) missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18,552,069 (GRCm39) missense probably benign 0.01
R7849:Muc16 UTSW 9 18,551,801 (GRCm39) missense probably benign 0.01
R7884:Muc16 UTSW 9 18,553,990 (GRCm39) missense unknown
R7885:Muc16 UTSW 9 18,550,760 (GRCm39) missense probably benign 0.10
R7886:Muc16 UTSW 9 18,497,278 (GRCm39) missense probably benign 0.03
R7899:Muc16 UTSW 9 18,551,993 (GRCm39) missense probably benign 0.01
R7904:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7921:Muc16 UTSW 9 18,570,614 (GRCm39) missense unknown
R7922:Muc16 UTSW 9 18,496,121 (GRCm39) missense probably benign 0.16
R7948:Muc16 UTSW 9 18,553,786 (GRCm39) missense unknown
R7957:Muc16 UTSW 9 18,554,767 (GRCm39) missense unknown
R7972:Muc16 UTSW 9 18,557,060 (GRCm39) nonsense probably null
R7992:Muc16 UTSW 9 18,567,725 (GRCm39) missense unknown
R7998:Muc16 UTSW 9 18,551,188 (GRCm39) missense probably benign 0.04
R8014:Muc16 UTSW 9 18,566,171 (GRCm39) missense unknown
R8033:Muc16 UTSW 9 18,547,902 (GRCm39) missense probably benign 0.26
R8052:Muc16 UTSW 9 18,570,347 (GRCm39) missense unknown
R8058:Muc16 UTSW 9 18,571,298 (GRCm39) nonsense probably null
R8088:Muc16 UTSW 9 18,430,596 (GRCm39) nonsense probably null
R8095:Muc16 UTSW 9 18,496,126 (GRCm39) nonsense probably null
R8111:Muc16 UTSW 9 18,503,925 (GRCm39) missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18,570,033 (GRCm39) missense unknown
R8117:Muc16 UTSW 9 18,420,206 (GRCm39) nonsense probably null
R8137:Muc16 UTSW 9 18,556,972 (GRCm39) missense unknown
R8196:Muc16 UTSW 9 18,556,630 (GRCm39) missense unknown
R8218:Muc16 UTSW 9 18,548,315 (GRCm39) missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18,554,273 (GRCm39) missense unknown
R8313:Muc16 UTSW 9 18,436,443 (GRCm39) missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18,569,339 (GRCm39) missense unknown
R8342:Muc16 UTSW 9 18,569,981 (GRCm39) missense unknown
R8351:Muc16 UTSW 9 18,571,181 (GRCm39) missense unknown
R8356:Muc16 UTSW 9 18,570,074 (GRCm39) missense unknown
R8360:Muc16 UTSW 9 18,436,554 (GRCm39) missense probably benign 0.01
R8418:Muc16 UTSW 9 18,430,926 (GRCm39) missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18,448,807 (GRCm39) missense probably damaging 0.99
R8437:Muc16 UTSW 9 18,569,220 (GRCm39) missense unknown
R8463:Muc16 UTSW 9 18,570,435 (GRCm39) missense unknown
R8466:Muc16 UTSW 9 18,554,444 (GRCm39) missense unknown
R8512:Muc16 UTSW 9 18,549,488 (GRCm39) missense probably benign 0.01
R8518:Muc16 UTSW 9 18,430,927 (GRCm39) missense probably benign 0.12
R8556:Muc16 UTSW 9 18,552,233 (GRCm39) missense probably benign 0.01
R8679:Muc16 UTSW 9 18,557,744 (GRCm39) missense unknown
R8680:Muc16 UTSW 9 18,556,015 (GRCm39) missense unknown
R8720:Muc16 UTSW 9 18,552,896 (GRCm39) missense probably benign 0.01
R8729:Muc16 UTSW 9 18,571,346 (GRCm39) missense unknown
R8736:Muc16 UTSW 9 18,462,139 (GRCm39) nonsense probably null
R8739:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R8807:Muc16 UTSW 9 18,567,353 (GRCm39) missense unknown
R8830:Muc16 UTSW 9 18,557,365 (GRCm39) missense unknown
R8871:Muc16 UTSW 9 18,567,344 (GRCm39) missense unknown
R8884:Muc16 UTSW 9 18,555,496 (GRCm39) missense unknown
R8923:Muc16 UTSW 9 18,549,972 (GRCm39) missense probably benign 0.01
R8948:Muc16 UTSW 9 18,558,529 (GRCm39) missense unknown
R8949:Muc16 UTSW 9 18,432,221 (GRCm39) critical splice donor site probably null
R8987:Muc16 UTSW 9 18,462,981 (GRCm39) nonsense probably null
R8997:Muc16 UTSW 9 18,518,763 (GRCm39) intron probably benign
R9013:Muc16 UTSW 9 18,424,069 (GRCm39) missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18,550,015 (GRCm39) small insertion probably benign
R9036:Muc16 UTSW 9 18,555,975 (GRCm39) missense unknown
R9040:Muc16 UTSW 9 18,556,082 (GRCm39) nonsense probably null
R9065:Muc16 UTSW 9 18,554,305 (GRCm39) missense unknown
R9089:Muc16 UTSW 9 18,555,846 (GRCm39) missense unknown
R9098:Muc16 UTSW 9 18,554,975 (GRCm39) missense unknown
R9100:Muc16 UTSW 9 18,556,966 (GRCm39) missense unknown
R9128:Muc16 UTSW 9 18,558,878 (GRCm39) missense unknown
R9169:Muc16 UTSW 9 18,567,824 (GRCm39) missense unknown
R9180:Muc16 UTSW 9 18,554,038 (GRCm39) missense unknown
R9191:Muc16 UTSW 9 18,556,106 (GRCm39) missense unknown
R9203:Muc16 UTSW 9 18,462,984 (GRCm39) missense unknown
R9232:Muc16 UTSW 9 18,567,336 (GRCm39) missense unknown
R9240:Muc16 UTSW 9 18,449,309 (GRCm39) missense unknown
R9254:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9330:Muc16 UTSW 9 18,552,332 (GRCm39) missense probably benign 0.04
R9347:Muc16 UTSW 9 18,571,511 (GRCm39) missense unknown
R9358:Muc16 UTSW 9 18,553,520 (GRCm39) missense probably benign 0.01
R9359:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9379:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9403:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9422:Muc16 UTSW 9 18,553,102 (GRCm39) missense probably benign 0.01
R9433:Muc16 UTSW 9 18,483,937 (GRCm39) missense probably benign 0.09
R9438:Muc16 UTSW 9 18,559,028 (GRCm39) missense unknown
R9442:Muc16 UTSW 9 18,566,624 (GRCm39) missense unknown
R9453:Muc16 UTSW 9 18,572,061 (GRCm39) missense unknown
R9467:Muc16 UTSW 9 18,508,331 (GRCm39) missense probably benign 0.03
R9490:Muc16 UTSW 9 18,568,149 (GRCm39) nonsense probably null
R9519:Muc16 UTSW 9 18,498,216 (GRCm39) missense probably benign 0.03
R9524:Muc16 UTSW 9 18,497,314 (GRCm39) missense probably benign 0.03
R9556:Muc16 UTSW 9 18,569,934 (GRCm39) missense unknown
R9583:Muc16 UTSW 9 18,549,973 (GRCm39) missense probably benign 0.01
R9600:Muc16 UTSW 9 18,567,147 (GRCm39) missense unknown
R9638:Muc16 UTSW 9 18,550,626 (GRCm39) missense probably benign 0.12
R9650:Muc16 UTSW 9 18,553,762 (GRCm39) missense unknown
R9652:Muc16 UTSW 9 18,498,178 (GRCm39) missense probably benign 0.03
R9666:Muc16 UTSW 9 18,567,285 (GRCm39) missense unknown
R9682:Muc16 UTSW 9 18,553,874 (GRCm39) missense unknown
R9765:Muc16 UTSW 9 18,548,494 (GRCm39) missense probably benign 0.16
R9766:Muc16 UTSW 9 18,552,383 (GRCm39) missense probably benign 0.01
R9766:Muc16 UTSW 9 18,548,153 (GRCm39) missense probably benign 0.08
R9776:Muc16 UTSW 9 18,570,675 (GRCm39) missense unknown
R9782:Muc16 UTSW 9 18,548,066 (GRCm39) missense possibly damaging 0.64
Z1177:Muc16 UTSW 9 18,569,157 (GRCm39) nonsense probably null
Z1177:Muc16 UTSW 9 18,448,867 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ATGACTGTTCCCCAGGTTACAG -3'
(R):5'- GCTATGACATACACTGGAACAAG -3'

Sequencing Primer
(F):5'- CTCAGATTTGATGGTGCACGACTC -3'
(R):5'- CTGGAACAAGACATCCTATACTTGGG -3'
Posted On 2022-02-07