Incidental Mutation 'R9208:Mpp7'
ID 698670
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Name membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms 2810038M04Rik, LOC381166, 5430426E14Rik, 1110068J02Rik
MMRRC Submission 068982-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R9208 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 7347959-7626866 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7403327 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 328 (R328G)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000115869
AA Change: R328G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: R328G

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 T A 12: 84,153,358 (GRCm39) L200Q possibly damaging Het
Apbb1 A G 7: 105,208,727 (GRCm39) S569P probably damaging Het
Atl3 A G 19: 7,487,447 (GRCm39) I121V probably benign Het
C87436 A G 6: 86,423,227 (GRCm39) D267G probably benign Het
Ccdc7a T A 8: 129,472,482 (GRCm39) I1617F possibly damaging Het
Cic T C 7: 24,987,502 (GRCm39) F1397L probably benign Het
Cln6 T A 9: 62,756,465 (GRCm39) M203K probably benign Het
Clock A G 5: 76,384,871 (GRCm39) S449P probably benign Het
Cse1l C A 2: 166,783,185 (GRCm39) N743K probably damaging Het
Cyp1a2 A G 9: 57,589,583 (GRCm39) I77T probably damaging Het
D6Wsu163e A G 6: 126,943,932 (GRCm39) I443V probably benign Het
Dctn1 T C 6: 83,176,684 (GRCm39) V1246A probably benign Het
Dennd5b T C 6: 149,002,698 (GRCm39) E37G probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Ecpas A T 4: 58,875,444 (GRCm39) D173E probably damaging Het
Ercc5 T C 1: 44,217,503 (GRCm39) W949R possibly damaging Het
Fam13c A G 10: 70,388,869 (GRCm39) E465G probably damaging Het
Fam83d T A 2: 158,610,466 (GRCm39) C145S probably damaging Het
Fbln7 T A 2: 128,737,343 (GRCm39) V386E probably damaging Het
Fpr3 A T 17: 18,191,131 (GRCm39) Q134L probably damaging Het
Gm3636 T A 14: 17,955,001 (GRCm39) R5S possibly damaging Het
Gna15 A G 10: 81,345,224 (GRCm39) S214P probably benign Het
Hdac9 A G 12: 34,220,101 (GRCm39) M897T probably benign Het
Hdc T C 2: 126,436,600 (GRCm39) N424D probably benign Het
Krtap27-1 A G 16: 88,468,316 (GRCm39) V76A possibly damaging Het
Lrrd1 T A 5: 3,900,995 (GRCm39) H433Q probably damaging Het
Ltn1 T C 16: 87,197,298 (GRCm39) D1180G probably benign Het
Macf1 A G 4: 123,577,925 (GRCm39) C20R unknown Het
Mphosph9 T C 5: 124,450,854 (GRCm39) N306D probably damaging Het
Mslnl C T 17: 25,961,694 (GRCm39) P117S possibly damaging Het
Muc16 T A 9: 18,419,833 (GRCm39) K117M probably damaging Het
Mycbp2 T C 14: 103,532,664 (GRCm39) N430S probably benign Het
Myl1 T C 1: 66,973,683 (GRCm39) I8V probably benign Het
Ncdn A T 4: 126,644,041 (GRCm39) D260E probably benign Het
Nkx3-2 T A 5: 41,919,114 (GRCm39) R291S probably damaging Het
Nr4a2 A G 2: 56,999,093 (GRCm39) V448A probably damaging Het
Nrip1 T C 16: 76,089,616 (GRCm39) E647G possibly damaging Het
Or4c12 C A 2: 89,773,725 (GRCm39) V245L possibly damaging Het
Or52a5b A G 7: 103,417,478 (GRCm39) I42T probably benign Het
Or8c14-ps1 T C 9: 38,101,120 (GRCm39) M33T possibly damaging Het
Or8s10 C A 15: 98,335,614 (GRCm39) A88E probably benign Het
Patj A T 4: 98,427,310 (GRCm39) I172F unknown Het
Per1 T C 11: 68,995,636 (GRCm39) S739P possibly damaging Het
Plekhn1 A C 4: 156,306,859 (GRCm39) V510G possibly damaging Het
Plxna4 A T 6: 32,494,379 (GRCm39) V79D probably damaging Het
Pram1 A G 17: 33,859,801 (GRCm39) T123A probably benign Het
Ptpn23 C A 9: 110,237,101 (GRCm39) probably null Het
Rcbtb2 C T 14: 73,414,500 (GRCm39) S437L probably damaging Het
Resf1 C T 6: 149,228,027 (GRCm39) L358F probably damaging Het
Rxfp4 T A 3: 88,559,390 (GRCm39) R354* probably null Het
Serpinb5 A G 1: 106,803,853 (GRCm39) T180A probably damaging Het
Slc7a14 T A 3: 31,281,359 (GRCm39) D317V probably damaging Het
Slco5a1 A G 1: 13,059,802 (GRCm39) probably null Het
Snx14 T A 9: 88,265,832 (GRCm39) T768S probably benign Het
Sorbs1 T A 19: 40,353,462 (GRCm39) probably benign Het
Stambp C T 6: 83,528,954 (GRCm39) A364T probably damaging Het
Tgm3 T A 2: 129,865,618 (GRCm39) I6N possibly damaging Het
Tmem106b A T 6: 13,082,430 (GRCm39) T202S probably damaging Het
Tnfsf8 A G 4: 63,752,450 (GRCm39) V205A probably benign Het
Treml2 A T 17: 48,614,922 (GRCm39) R136* probably null Het
Trim46 T C 3: 89,142,466 (GRCm39) T674A possibly damaging Het
Trmt13 T A 3: 116,376,356 (GRCm39) Y345F possibly damaging Het
Tspyl4 A G 10: 34,173,568 (GRCm39) H20R probably benign Het
Uvssa T C 5: 33,571,419 (GRCm39) probably null Het
Vmn1r192 A T 13: 22,371,401 (GRCm39) F273Y probably damaging Het
Vmn2r45 A T 7: 8,486,298 (GRCm39) I330N probably damaging Het
Zfp40 A G 17: 23,394,551 (GRCm39) F679L probably damaging Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7,353,297 (GRCm39) missense probably benign 0.00
IGL01575:Mpp7 APN 18 7,403,365 (GRCm39) splice site probably benign
IGL02973:Mpp7 APN 18 7,403,297 (GRCm39) missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7,461,637 (GRCm39) critical splice donor site probably null
IGL03224:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
IGL03248:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
R0040:Mpp7 UTSW 18 7,403,180 (GRCm39) splice site probably benign
R0089:Mpp7 UTSW 18 7,439,555 (GRCm39) splice site probably benign
R1413:Mpp7 UTSW 18 7,350,977 (GRCm39) missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7,350,984 (GRCm39) missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7,350,967 (GRCm39) makesense probably null
R2379:Mpp7 UTSW 18 7,403,345 (GRCm39) nonsense probably null
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7,351,085 (GRCm39) missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7,444,062 (GRCm39) missense probably benign 0.23
R4574:Mpp7 UTSW 18 7,353,228 (GRCm39) missense probably benign 0.02
R4772:Mpp7 UTSW 18 7,379,983 (GRCm39) splice site probably null
R5066:Mpp7 UTSW 18 7,513,002 (GRCm39) missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7,458,930 (GRCm39) critical splice donor site probably null
R5451:Mpp7 UTSW 18 7,442,855 (GRCm39) missense probably null 0.95
R5578:Mpp7 UTSW 18 7,355,101 (GRCm39) missense probably benign
R5651:Mpp7 UTSW 18 7,355,016 (GRCm39) critical splice donor site probably null
R5787:Mpp7 UTSW 18 7,461,682 (GRCm39) missense probably benign
R6979:Mpp7 UTSW 18 7,355,049 (GRCm39) missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7,441,623 (GRCm39) missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7,351,079 (GRCm39) missense probably damaging 0.98
R7517:Mpp7 UTSW 18 7,440,183 (GRCm39) nonsense probably null
R8278:Mpp7 UTSW 18 7,444,025 (GRCm39) missense probably benign
R8373:Mpp7 UTSW 18 7,444,096 (GRCm39) missense probably damaging 1.00
R8676:Mpp7 UTSW 18 7,440,430 (GRCm39) critical splice donor site probably null
R9206:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9439:Mpp7 UTSW 18 7,461,692 (GRCm39) nonsense probably null
R9790:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
R9791:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
X0028:Mpp7 UTSW 18 7,403,273 (GRCm39) missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7,355,062 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGATGAAGGGAATTTTAGCTTG -3'
(R):5'- TCTCACCAGCCGTCGATATC -3'

Sequencing Primer
(F):5'- TTTGTCATGGATCTGCCG -3'
(R):5'- AGCCGTCGATATCCTTTTTGAAG -3'
Posted On 2022-02-07