Incidental Mutation 'R9209:Tnn'
ID 698679
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms Tnw, tenascin-W
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 160085029-160153580 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160126416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 590 (S590G)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably benign
Transcript: ENSMUST00000039178
AA Change: S590G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: S590G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131919
AA Change: S590G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: S590G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,413 N513K possibly damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts5 A G 16: 85,870,083 V507A probably damaging Het
Ap3d1 A G 10: 80,719,084 V469A probably benign Het
Arhgef4 G T 1: 34,725,160 probably null Het
Arhgef4 A T 1: 34,810,495 Q389L probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Azin2 T C 4: 128,947,548 E275G probably damaging Het
Bhlhe23 A G 2: 180,776,350 S132P probably damaging Het
Capn12 A G 7: 28,881,818 Y32C probably damaging Het
Celsr2 A T 3: 108,414,033 S488T probably benign Het
Cenpx A G 11: 120,711,756 V27A possibly damaging Het
Clca2 G A 3: 145,072,244 P760L probably benign Het
Clstn3 T C 6: 124,431,612 S951G probably benign Het
Clybl C A 14: 122,384,258 P286Q probably benign Het
Cmya5 T A 13: 93,090,358 M2741L probably benign Het
Cntnap2 G A 6: 47,049,249 G944E probably damaging Het
Col8a1 A C 16: 57,626,920 Y742* probably null Het
Crb1 T C 1: 139,243,313 K780E probably damaging Het
Crygc T A 1: 65,073,217 Y66F probably benign Het
Cyp2b9 G A 7: 26,173,579 G49E possibly damaging Het
D130043K22Rik T C 13: 24,857,107 S171P possibly damaging Het
Dhx36 T C 3: 62,471,474 I890V probably benign Het
Dpp9 C T 17: 56,205,765 G148S probably damaging Het
Eml6 G T 11: 29,831,175 S619Y probably damaging Het
Enpp4 A T 17: 44,101,361 L319* probably null Het
Esyt1 T C 10: 128,525,487 S113G probably benign Het
Fat1 A G 8: 44,951,754 D514G possibly damaging Het
Fbxo16 G A 14: 65,287,145 R38Q probably damaging Het
Fchsd1 A T 18: 37,959,653 M668K unknown Het
Gpr149 C T 3: 62,603,672 S302N probably benign Het
Gsap A G 5: 21,228,066 K258E probably benign Het
Helq C A 5: 100,791,352 V443F probably benign Het
Helq T A 5: 100,791,353 K442N probably damaging Het
Ighv1-37 T C 12: 114,896,503 E29G possibly damaging Het
Ighv1-9 C A 12: 114,584,000 M1I probably null Het
Itga6 T G 2: 71,841,133 F743V probably benign Het
Lpin1 C A 12: 16,538,547 D881Y Het
Lypd8 T A 11: 58,382,814 C40S possibly damaging Het
Macf1 C T 4: 123,432,434 R5092Q probably damaging Het
Mcm7 A G 5: 138,168,331 probably null Het
Micall2 G A 5: 139,710,415 T831I unknown Het
Myo18b A T 5: 112,875,061 M155K unknown Het
Nckap5 T A 1: 125,940,191 H201L unknown Het
Ndst2 A T 14: 20,729,172 D333E possibly damaging Het
Nlgn1 A G 3: 25,912,640 probably null Het
Nup188 T G 2: 30,342,385 Y1483D probably benign Het
Olfr1214 A C 2: 88,987,713 L163* probably null Het
Olfr490 T A 7: 108,286,319 Y269F probably benign Het
Olfr503 A C 7: 108,545,457 I311L probably benign Het
Olfr629 T A 7: 103,741,112 S43C probably benign Het
Olfr952 T A 9: 39,426,339 H244L probably damaging Het
Peg3 A C 7: 6,708,227 I1332S possibly damaging Het
Piezo2 T C 18: 63,021,301 K2469R probably damaging Het
Pik3cg T C 12: 32,197,313 M804V probably damaging Het
Polq A T 16: 37,048,649 I794F possibly damaging Het
Rasgef1b A G 5: 99,222,332 V437A probably benign Het
Rdm1 T A 11: 101,628,031 D21E probably benign Het
Ripk4 G T 16: 97,750,111 Q219K possibly damaging Het
Ropn1l T C 15: 31,441,325 I217V Het
Sdf2 T C 11: 78,246,032 S13P unknown Het
Selenbp1 A G 3: 94,939,768 T202A probably benign Het
Slfn5 T C 11: 82,960,107 F410S possibly damaging Het
Srrm2 A G 17: 23,820,906 T2175A probably benign Het
St6galnac3 T C 3: 153,411,723 Y121C possibly damaging Het
Stat1 A G 1: 52,145,178 N417S probably benign Het
Tead1 T C 7: 112,876,171 F276L probably damaging Het
Teddm3 A T 16: 21,152,987 S277R probably benign Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmem156 G A 5: 65,073,784 L248F probably damaging Het
Trmt44 A G 5: 35,574,078 probably null Het
Upp2 T A 2: 58,778,010 Y238* probably null Het
Usp32 T C 11: 85,040,012 T531A probably damaging Het
Vmn2r78 A T 7: 86,920,223 D108V probably benign Het
Wdfy3 G T 5: 101,930,964 A824E probably benign Het
Xylt1 T C 7: 117,656,647 V814A probably benign Het
Zfy1 C T Y: 732,990 R281H unknown Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8427:Tnn UTSW 1 160130686 missense probably damaging 0.99
R8433:Tnn UTSW 1 160097220 missense possibly damaging 0.81
R8479:Tnn UTSW 1 160122827 missense probably benign 0.06
R8505:Tnn UTSW 1 160146023 missense probably damaging 0.98
R8554:Tnn UTSW 1 160110416 missense probably damaging 1.00
R8717:Tnn UTSW 1 160116276 missense possibly damaging 0.51
R8850:Tnn UTSW 1 160110244 critical splice donor site probably null
R8928:Tnn UTSW 1 160125529 missense probably damaging 1.00
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGTCTCTGGTCTCAGGTCC -3'
(R):5'- AGAGTAATAAAGCTTACCCTCCTCC -3'

Sequencing Primer
(F):5'- CCAACCTGTGGTACCATGC -3'
(R):5'- TCCCTTAAAGAAATTGACAGTCCAG -3'
Posted On 2022-02-07