Incidental Mutation 'R9209:Celsr2'
ID 698691
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms mfmi1, EGFL2, flamingo
MMRRC Submission
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 108390851-108415552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108414033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 488 (S488T)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090558
AA Change: S488T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: S488T

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,413 N513K possibly damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts5 A G 16: 85,870,083 V507A probably damaging Het
Ap3d1 A G 10: 80,719,084 V469A probably benign Het
Arhgef4 G T 1: 34,725,160 probably null Het
Arhgef4 A T 1: 34,810,495 Q389L probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Azin2 T C 4: 128,947,548 E275G probably damaging Het
Bhlhe23 A G 2: 180,776,350 S132P probably damaging Het
Capn12 A G 7: 28,881,818 Y32C probably damaging Het
Cenpx A G 11: 120,711,756 V27A possibly damaging Het
Clca2 G A 3: 145,072,244 P760L probably benign Het
Clstn3 T C 6: 124,431,612 S951G probably benign Het
Clybl C A 14: 122,384,258 P286Q probably benign Het
Cmya5 T A 13: 93,090,358 M2741L probably benign Het
Cntnap2 G A 6: 47,049,249 G944E probably damaging Het
Col8a1 A C 16: 57,626,920 Y742* probably null Het
Crb1 T C 1: 139,243,313 K780E probably damaging Het
Crygc T A 1: 65,073,217 Y66F probably benign Het
Cyp2b9 G A 7: 26,173,579 G49E possibly damaging Het
D130043K22Rik T C 13: 24,857,107 S171P possibly damaging Het
Dhx36 T C 3: 62,471,474 I890V probably benign Het
Dpp9 C T 17: 56,205,765 G148S probably damaging Het
Eml6 G T 11: 29,831,175 S619Y probably damaging Het
Enpp4 A T 17: 44,101,361 L319* probably null Het
Esyt1 T C 10: 128,525,487 S113G probably benign Het
Fat1 A G 8: 44,951,754 D514G possibly damaging Het
Fbxo16 G A 14: 65,287,145 R38Q probably damaging Het
Fchsd1 A T 18: 37,959,653 M668K unknown Het
Gpr149 C T 3: 62,603,672 S302N probably benign Het
Gsap A G 5: 21,228,066 K258E probably benign Het
Helq C A 5: 100,791,352 V443F probably benign Het
Helq T A 5: 100,791,353 K442N probably damaging Het
Ighv1-37 T C 12: 114,896,503 E29G possibly damaging Het
Ighv1-9 C A 12: 114,584,000 M1I probably null Het
Itga6 T G 2: 71,841,133 F743V probably benign Het
Lpin1 C A 12: 16,538,547 D881Y Het
Lypd8 T A 11: 58,382,814 C40S possibly damaging Het
Macf1 C T 4: 123,432,434 R5092Q probably damaging Het
Mcm7 A G 5: 138,168,331 probably null Het
Micall2 G A 5: 139,710,415 T831I unknown Het
Myo18b A T 5: 112,875,061 M155K unknown Het
Nckap5 T A 1: 125,940,191 H201L unknown Het
Ndst2 A T 14: 20,729,172 D333E possibly damaging Het
Nlgn1 A G 3: 25,912,640 probably null Het
Nup188 T G 2: 30,342,385 Y1483D probably benign Het
Olfr1214 A C 2: 88,987,713 L163* probably null Het
Olfr490 T A 7: 108,286,319 Y269F probably benign Het
Olfr503 A C 7: 108,545,457 I311L probably benign Het
Olfr629 T A 7: 103,741,112 S43C probably benign Het
Olfr952 T A 9: 39,426,339 H244L probably damaging Het
Peg3 A C 7: 6,708,227 I1332S possibly damaging Het
Piezo2 T C 18: 63,021,301 K2469R probably damaging Het
Pik3cg T C 12: 32,197,313 M804V probably damaging Het
Polq A T 16: 37,048,649 I794F possibly damaging Het
Rasgef1b A G 5: 99,222,332 V437A probably benign Het
Rdm1 T A 11: 101,628,031 D21E probably benign Het
Ripk4 G T 16: 97,750,111 Q219K possibly damaging Het
Ropn1l T C 15: 31,441,325 I217V Het
Sdf2 T C 11: 78,246,032 S13P unknown Het
Selenbp1 A G 3: 94,939,768 T202A probably benign Het
Slfn5 T C 11: 82,960,107 F410S possibly damaging Het
Srrm2 A G 17: 23,820,906 T2175A probably benign Het
St6galnac3 T C 3: 153,411,723 Y121C possibly damaging Het
Stat1 A G 1: 52,145,178 N417S probably benign Het
Tead1 T C 7: 112,876,171 F276L probably damaging Het
Teddm3 A T 16: 21,152,987 S277R probably benign Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmem156 G A 5: 65,073,784 L248F probably damaging Het
Tnn T C 1: 160,126,416 S590G probably benign Het
Trmt44 A G 5: 35,574,078 probably null Het
Upp2 T A 2: 58,778,010 Y238* probably null Het
Usp32 T C 11: 85,040,012 T531A probably damaging Het
Vmn2r78 A T 7: 86,920,223 D108V probably benign Het
Wdfy3 G T 5: 101,930,964 A824E probably benign Het
Xylt1 T C 7: 117,656,647 V814A probably benign Het
Zfy1 C T Y: 732,990 R281H unknown Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
barrow UTSW 3 108394965 missense possibly damaging 0.92
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
R7062:Celsr2 UTSW 3 108402510 missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108397865 missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108415359 missense unknown
R7326:Celsr2 UTSW 3 108394995 missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108402457 missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108413090 missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R7613:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108413490 missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108398588 missense probably benign
R7687:Celsr2 UTSW 3 108397769 missense probably benign 0.27
R7695:Celsr2 UTSW 3 108402753 missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108403969 missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108412655 missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108396455 missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108413531 missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108395636 missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108392633 makesense probably null
R8435:Celsr2 UTSW 3 108414399 missense probably benign
R8438:Celsr2 UTSW 3 108393823 missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8460:Celsr2 UTSW 3 108396777 missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108412851 nonsense probably null
R8479:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8480:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8512:Celsr2 UTSW 3 108413838 missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108406860 missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108397073 missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108396127 splice site probably benign
R8888:Celsr2 UTSW 3 108413564 missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108413564 missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108396566 missense probably benign 0.00
R9119:Celsr2 UTSW 3 108401972 missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108402546 missense probably benign 0.04
R9342:Celsr2 UTSW 3 108413126 missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108414768 missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108393758 missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108414518 missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108415262 missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108401599 missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108394235 missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108393131 missense probably benign 0.10
Z1176:Celsr2 UTSW 3 108412341 missense probably benign 0.07
Z1177:Celsr2 UTSW 3 108412220 missense probably damaging 1.00
Z1177:Celsr2 UTSW 3 108413571 missense probably benign 0.32
Z1191:Celsr2 UTSW 3 108414549 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTAGAAATCAACCTCTTCCCGATC -3'
(R):5'- ATGCCCTAGTGCACTACAGC -3'

Sequencing Primer
(F):5'- AGAGATCCAGCCTGTGCCATTG -3'
(R):5'- CATCATGAGTGGCAATGCTC -3'
Posted On 2022-02-07