Incidental Mutation 'R9209:Celsr2'
ID 698691
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms EGFL2, Adgrc2, flamingo, mfmi1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 108298167-108323383 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108321349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 488 (S488T)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090558
AA Change: S488T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: S488T

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,837 (GRCm39) N513K possibly damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts5 A G 16: 85,666,971 (GRCm39) V507A probably damaging Het
Ap3d1 A G 10: 80,554,918 (GRCm39) V469A probably benign Het
Arhgef4 G T 1: 34,764,241 (GRCm39) probably null Het
Arhgef4 A T 1: 34,849,576 (GRCm39) Q389L probably benign Het
Atad2 A G 15: 57,980,194 (GRCm39) V106A possibly damaging Het
Azin2 T C 4: 128,841,341 (GRCm39) E275G probably damaging Het
Bhlhe23 A G 2: 180,418,143 (GRCm39) S132P probably damaging Het
Capn12 A G 7: 28,581,243 (GRCm39) Y32C probably damaging Het
Cenpx A G 11: 120,602,582 (GRCm39) V27A possibly damaging Het
Clca3a2 G A 3: 144,778,005 (GRCm39) P760L probably benign Het
Clstn3 T C 6: 124,408,571 (GRCm39) S951G probably benign Het
Clybl C A 14: 122,621,670 (GRCm39) P286Q probably benign Het
Cmya5 T A 13: 93,226,866 (GRCm39) M2741L probably benign Het
Cntnap2 G A 6: 47,026,183 (GRCm39) G944E probably damaging Het
Col8a1 A C 16: 57,447,283 (GRCm39) Y742* probably null Het
Crb1 T C 1: 139,171,051 (GRCm39) K780E probably damaging Het
Crygc T A 1: 65,112,376 (GRCm39) Y66F probably benign Het
Cyp2b9 G A 7: 25,873,004 (GRCm39) G49E possibly damaging Het
D130043K22Rik T C 13: 25,041,090 (GRCm39) S171P possibly damaging Het
Dhx36 T C 3: 62,378,895 (GRCm39) I890V probably benign Het
Dpp9 C T 17: 56,512,765 (GRCm39) G148S probably damaging Het
Eml6 G T 11: 29,781,175 (GRCm39) S619Y probably damaging Het
Enpp4 A T 17: 44,412,252 (GRCm39) L319* probably null Het
Esyt1 T C 10: 128,361,356 (GRCm39) S113G probably benign Het
Fat1 A G 8: 45,404,791 (GRCm39) D514G possibly damaging Het
Fbxo16 G A 14: 65,524,594 (GRCm39) R38Q probably damaging Het
Fchsd1 A T 18: 38,092,706 (GRCm39) M668K unknown Het
Gpr149 C T 3: 62,511,093 (GRCm39) S302N probably benign Het
Gsap A G 5: 21,433,064 (GRCm39) K258E probably benign Het
Helq C A 5: 100,939,218 (GRCm39) V443F probably benign Het
Helq T A 5: 100,939,219 (GRCm39) K442N probably damaging Het
Ighv1-37 T C 12: 114,860,123 (GRCm39) E29G possibly damaging Het
Ighv1-9 C A 12: 114,547,620 (GRCm39) M1I probably null Het
Itga6 T G 2: 71,671,477 (GRCm39) F743V probably benign Het
Lpin1 C A 12: 16,588,548 (GRCm39) D881Y Het
Lypd8 T A 11: 58,273,640 (GRCm39) C40S possibly damaging Het
Macf1 C T 4: 123,326,227 (GRCm39) R5092Q probably damaging Het
Mcm7 A G 5: 138,166,593 (GRCm39) probably null Het
Micall2 G A 5: 139,696,170 (GRCm39) T831I unknown Het
Myo18b A T 5: 113,022,927 (GRCm39) M155K unknown Het
Nckap5 T A 1: 125,867,928 (GRCm39) H201L unknown Het
Ndst2 A T 14: 20,779,240 (GRCm39) D333E possibly damaging Het
Nlgn1 A G 3: 25,966,804 (GRCm39) probably null Het
Nup188 T G 2: 30,232,397 (GRCm39) Y1483D probably benign Het
Or4c109 A C 2: 88,818,057 (GRCm39) L163* probably null Het
Or52ae9 T A 7: 103,390,319 (GRCm39) S43C probably benign Het
Or52n4b A C 7: 108,144,664 (GRCm39) I311L probably benign Het
Or5p66 T A 7: 107,885,526 (GRCm39) Y269F probably benign Het
Or8g33 T A 9: 39,337,635 (GRCm39) H244L probably damaging Het
Peg3 A C 7: 6,711,226 (GRCm39) I1332S possibly damaging Het
Piezo2 T C 18: 63,154,372 (GRCm39) K2469R probably damaging Het
Pik3cg T C 12: 32,247,312 (GRCm39) M804V probably damaging Het
Polq A T 16: 36,869,011 (GRCm39) I794F possibly damaging Het
Rasgef1b A G 5: 99,370,191 (GRCm39) V437A probably benign Het
Rdm1 T A 11: 101,518,857 (GRCm39) D21E probably benign Het
Ripk4 G T 16: 97,551,311 (GRCm39) Q219K possibly damaging Het
Ropn1l T C 15: 31,441,471 (GRCm39) I217V Het
Sdf2 T C 11: 78,136,858 (GRCm39) S13P unknown Het
Selenbp1 A G 3: 94,847,079 (GRCm39) T202A probably benign Het
Slfn5 T C 11: 82,850,933 (GRCm39) F410S possibly damaging Het
Srrm2 A G 17: 24,039,880 (GRCm39) T2175A probably benign Het
St6galnac3 T C 3: 153,117,360 (GRCm39) Y121C possibly damaging Het
Stat1 A G 1: 52,184,337 (GRCm39) N417S probably benign Het
Tead1 T C 7: 112,475,378 (GRCm39) F276L probably damaging Het
Teddm3 A T 16: 20,971,737 (GRCm39) S277R probably benign Het
Tmc2 A G 2: 130,103,317 (GRCm39) probably null Het
Tmem156 G A 5: 65,231,127 (GRCm39) L248F probably damaging Het
Tnn T C 1: 159,953,986 (GRCm39) S590G probably benign Het
Trmt44 A G 5: 35,731,422 (GRCm39) probably null Het
Upp2 T A 2: 58,668,022 (GRCm39) Y238* probably null Het
Usp32 T C 11: 84,930,838 (GRCm39) T531A probably damaging Het
Vmn2r78 A T 7: 86,569,431 (GRCm39) D108V probably benign Het
Wdfy3 G T 5: 102,078,830 (GRCm39) A824E probably benign Het
Xylt1 T C 7: 117,255,870 (GRCm39) V814A probably benign Het
Zfy1 C T Y: 732,990 (GRCm39) R281H unknown Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108,321,195 (GRCm39) missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108,310,586 (GRCm39) missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108,301,079 (GRCm39) missense probably benign 0.13
IGL01448:Celsr2 APN 3 108,300,555 (GRCm39) missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108,314,183 (GRCm39) missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108,322,159 (GRCm39) missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108,301,338 (GRCm39) missense probably benign 0.00
IGL02309:Celsr2 APN 3 108,303,327 (GRCm39) missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108,320,187 (GRCm39) missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108,321,271 (GRCm39) missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108,304,826 (GRCm39) missense probably benign 0.01
IGL02812:Celsr2 APN 3 108,321,429 (GRCm39) missense probably benign 0.25
IGL02894:Celsr2 APN 3 108,302,526 (GRCm39) missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108,320,256 (GRCm39) missense probably damaging 1.00
barrow UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
goldeneye UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108,308,154 (GRCm39) missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108,319,815 (GRCm39) missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108,321,378 (GRCm39) missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108,320,718 (GRCm39) missense probably benign 0.19
R0031:Celsr2 UTSW 3 108,320,379 (GRCm39) missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0090:Celsr2 UTSW 3 108,300,643 (GRCm39) splice site probably benign
R0140:Celsr2 UTSW 3 108,305,249 (GRCm39) missense probably benign 0.00
R0524:Celsr2 UTSW 3 108,308,903 (GRCm39) missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108,311,211 (GRCm39) critical splice donor site probably null
R0662:Celsr2 UTSW 3 108,305,836 (GRCm39) missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108,322,293 (GRCm39) missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108,319,939 (GRCm39) missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108,320,028 (GRCm39) missense probably benign 0.42
R0730:Celsr2 UTSW 3 108,305,922 (GRCm39) missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108,308,617 (GRCm39) missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108,321,654 (GRCm39) missense probably benign
R0989:Celsr2 UTSW 3 108,310,588 (GRCm39) missense probably benign 0.00
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108,301,055 (GRCm39) missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108,309,799 (GRCm39) missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108,320,836 (GRCm39) missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108,321,411 (GRCm39) missense probably benign
R1689:Celsr2 UTSW 3 108,314,620 (GRCm39) missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108,308,626 (GRCm39) missense probably benign 0.35
R1859:Celsr2 UTSW 3 108,303,946 (GRCm39) missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108,305,966 (GRCm39) missense probably benign 0.05
R1974:Celsr2 UTSW 3 108,321,530 (GRCm39) missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108,309,811 (GRCm39) missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108,320,509 (GRCm39) missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108,305,921 (GRCm39) missense probably benign 0.16
R2434:Celsr2 UTSW 3 108,311,795 (GRCm39) missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108,320,907 (GRCm39) missense probably benign 0.11
R3420:Celsr2 UTSW 3 108,321,732 (GRCm39) missense probably benign 0.03
R3712:Celsr2 UTSW 3 108,308,155 (GRCm39) missense probably benign
R3723:Celsr2 UTSW 3 108,304,731 (GRCm39) splice site probably benign
R3809:Celsr2 UTSW 3 108,310,555 (GRCm39) missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108,309,413 (GRCm39) missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108,321,294 (GRCm39) missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108,321,088 (GRCm39) missense probably benign 0.02
R4293:Celsr2 UTSW 3 108,300,993 (GRCm39) missense probably benign 0.01
R4458:Celsr2 UTSW 3 108,302,313 (GRCm39) missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108,302,532 (GRCm39) missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108,303,285 (GRCm39) missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108,304,547 (GRCm39) missense probably benign 0.24
R4732:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108,314,303 (GRCm39) missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108,310,074 (GRCm39) missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108,319,945 (GRCm39) missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108,319,674 (GRCm39) missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108,320,689 (GRCm39) missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108,301,312 (GRCm39) missense probably benign 0.05
R5120:Celsr2 UTSW 3 108,300,436 (GRCm39) missense probably benign 0.02
R5135:Celsr2 UTSW 3 108,305,975 (GRCm39) missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108,304,946 (GRCm39) missense probably benign 0.34
R5381:Celsr2 UTSW 3 108,310,073 (GRCm39) missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108,307,311 (GRCm39) missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108,299,974 (GRCm39) missense probably benign 0.01
R5528:Celsr2 UTSW 3 108,320,610 (GRCm39) missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108,310,119 (GRCm39) missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108,304,051 (GRCm39) missense probably null 0.49
R5697:Celsr2 UTSW 3 108,311,237 (GRCm39) nonsense probably null
R5718:Celsr2 UTSW 3 108,300,674 (GRCm39) missense probably benign
R5869:Celsr2 UTSW 3 108,321,225 (GRCm39) missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108,321,259 (GRCm39) missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108,308,561 (GRCm39) missense probably benign
R6054:Celsr2 UTSW 3 108,314,279 (GRCm39) missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108,300,444 (GRCm39) missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108,308,530 (GRCm39) missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108,319,890 (GRCm39) missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108,307,817 (GRCm39) critical splice donor site probably null
R7062:Celsr2 UTSW 3 108,309,826 (GRCm39) missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108,305,181 (GRCm39) missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108,322,675 (GRCm39) missense unknown
R7326:Celsr2 UTSW 3 108,302,311 (GRCm39) missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108,309,773 (GRCm39) missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108,320,406 (GRCm39) missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R7613:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108,320,806 (GRCm39) missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108,305,904 (GRCm39) missense probably benign
R7687:Celsr2 UTSW 3 108,305,085 (GRCm39) missense probably benign 0.27
R7695:Celsr2 UTSW 3 108,310,069 (GRCm39) missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108,311,285 (GRCm39) missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108,319,971 (GRCm39) missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108,303,771 (GRCm39) missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108,320,847 (GRCm39) missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108,302,952 (GRCm39) missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108,299,949 (GRCm39) makesense probably null
R8435:Celsr2 UTSW 3 108,321,715 (GRCm39) missense probably benign
R8438:Celsr2 UTSW 3 108,301,139 (GRCm39) missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8460:Celsr2 UTSW 3 108,304,093 (GRCm39) missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108,320,167 (GRCm39) nonsense probably null
R8479:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8480:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8512:Celsr2 UTSW 3 108,321,154 (GRCm39) missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108,314,176 (GRCm39) missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108,304,389 (GRCm39) missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108,303,443 (GRCm39) splice site probably benign
R8888:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108,303,882 (GRCm39) missense probably benign 0.00
R9119:Celsr2 UTSW 3 108,309,288 (GRCm39) missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108,309,862 (GRCm39) missense probably benign 0.04
R9342:Celsr2 UTSW 3 108,320,442 (GRCm39) missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108,322,084 (GRCm39) missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108,301,074 (GRCm39) missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108,321,834 (GRCm39) missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108,322,578 (GRCm39) missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108,308,915 (GRCm39) missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108,301,551 (GRCm39) missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108,303,426 (GRCm39) missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108,308,588 (GRCm39) missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108,321,433 (GRCm39) missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108,319,657 (GRCm39) missense probably benign 0.07
Z1176:Celsr2 UTSW 3 108,300,447 (GRCm39) missense probably benign 0.10
Z1177:Celsr2 UTSW 3 108,320,887 (GRCm39) missense probably benign 0.32
Z1177:Celsr2 UTSW 3 108,319,536 (GRCm39) missense probably damaging 1.00
Z1191:Celsr2 UTSW 3 108,321,865 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTAGAAATCAACCTCTTCCCGATC -3'
(R):5'- ATGCCCTAGTGCACTACAGC -3'

Sequencing Primer
(F):5'- AGAGATCCAGCCTGTGCCATTG -3'
(R):5'- CATCATGAGTGGCAATGCTC -3'
Posted On 2022-02-07