Incidental Mutation 'R9209:Wdfy3'
ID 698702
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms 2610509D04Rik, Ggtb3, Bchs, D5Ertd66e, Bwf1, Alfy
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 101980822-102217787 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 102078830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 824 (A824E)
Ref Sequence ENSEMBL: ENSMUSP00000052607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: A824E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: A824E

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172927
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: A824E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: A824E

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174698
AA Change: A796E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: A796E

DomainStartEndE-ValueType
Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: A824E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,837 (GRCm39) N513K possibly damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts5 A G 16: 85,666,971 (GRCm39) V507A probably damaging Het
Ap3d1 A G 10: 80,554,918 (GRCm39) V469A probably benign Het
Arhgef4 G T 1: 34,764,241 (GRCm39) probably null Het
Arhgef4 A T 1: 34,849,576 (GRCm39) Q389L probably benign Het
Atad2 A G 15: 57,980,194 (GRCm39) V106A possibly damaging Het
Azin2 T C 4: 128,841,341 (GRCm39) E275G probably damaging Het
Bhlhe23 A G 2: 180,418,143 (GRCm39) S132P probably damaging Het
Capn12 A G 7: 28,581,243 (GRCm39) Y32C probably damaging Het
Celsr2 A T 3: 108,321,349 (GRCm39) S488T probably benign Het
Cenpx A G 11: 120,602,582 (GRCm39) V27A possibly damaging Het
Clca3a2 G A 3: 144,778,005 (GRCm39) P760L probably benign Het
Clstn3 T C 6: 124,408,571 (GRCm39) S951G probably benign Het
Clybl C A 14: 122,621,670 (GRCm39) P286Q probably benign Het
Cmya5 T A 13: 93,226,866 (GRCm39) M2741L probably benign Het
Cntnap2 G A 6: 47,026,183 (GRCm39) G944E probably damaging Het
Col8a1 A C 16: 57,447,283 (GRCm39) Y742* probably null Het
Crb1 T C 1: 139,171,051 (GRCm39) K780E probably damaging Het
Crygc T A 1: 65,112,376 (GRCm39) Y66F probably benign Het
Cyp2b9 G A 7: 25,873,004 (GRCm39) G49E possibly damaging Het
D130043K22Rik T C 13: 25,041,090 (GRCm39) S171P possibly damaging Het
Dhx36 T C 3: 62,378,895 (GRCm39) I890V probably benign Het
Dpp9 C T 17: 56,512,765 (GRCm39) G148S probably damaging Het
Eml6 G T 11: 29,781,175 (GRCm39) S619Y probably damaging Het
Enpp4 A T 17: 44,412,252 (GRCm39) L319* probably null Het
Esyt1 T C 10: 128,361,356 (GRCm39) S113G probably benign Het
Fat1 A G 8: 45,404,791 (GRCm39) D514G possibly damaging Het
Fbxo16 G A 14: 65,524,594 (GRCm39) R38Q probably damaging Het
Fchsd1 A T 18: 38,092,706 (GRCm39) M668K unknown Het
Gpr149 C T 3: 62,511,093 (GRCm39) S302N probably benign Het
Gsap A G 5: 21,433,064 (GRCm39) K258E probably benign Het
Helq C A 5: 100,939,218 (GRCm39) V443F probably benign Het
Helq T A 5: 100,939,219 (GRCm39) K442N probably damaging Het
Ighv1-37 T C 12: 114,860,123 (GRCm39) E29G possibly damaging Het
Ighv1-9 C A 12: 114,547,620 (GRCm39) M1I probably null Het
Itga6 T G 2: 71,671,477 (GRCm39) F743V probably benign Het
Lpin1 C A 12: 16,588,548 (GRCm39) D881Y Het
Lypd8 T A 11: 58,273,640 (GRCm39) C40S possibly damaging Het
Macf1 C T 4: 123,326,227 (GRCm39) R5092Q probably damaging Het
Mcm7 A G 5: 138,166,593 (GRCm39) probably null Het
Micall2 G A 5: 139,696,170 (GRCm39) T831I unknown Het
Myo18b A T 5: 113,022,927 (GRCm39) M155K unknown Het
Nckap5 T A 1: 125,867,928 (GRCm39) H201L unknown Het
Ndst2 A T 14: 20,779,240 (GRCm39) D333E possibly damaging Het
Nlgn1 A G 3: 25,966,804 (GRCm39) probably null Het
Nup188 T G 2: 30,232,397 (GRCm39) Y1483D probably benign Het
Or4c109 A C 2: 88,818,057 (GRCm39) L163* probably null Het
Or52ae9 T A 7: 103,390,319 (GRCm39) S43C probably benign Het
Or52n4b A C 7: 108,144,664 (GRCm39) I311L probably benign Het
Or5p66 T A 7: 107,885,526 (GRCm39) Y269F probably benign Het
Or8g33 T A 9: 39,337,635 (GRCm39) H244L probably damaging Het
Peg3 A C 7: 6,711,226 (GRCm39) I1332S possibly damaging Het
Piezo2 T C 18: 63,154,372 (GRCm39) K2469R probably damaging Het
Pik3cg T C 12: 32,247,312 (GRCm39) M804V probably damaging Het
Polq A T 16: 36,869,011 (GRCm39) I794F possibly damaging Het
Rasgef1b A G 5: 99,370,191 (GRCm39) V437A probably benign Het
Rdm1 T A 11: 101,518,857 (GRCm39) D21E probably benign Het
Ripk4 G T 16: 97,551,311 (GRCm39) Q219K possibly damaging Het
Ropn1l T C 15: 31,441,471 (GRCm39) I217V Het
Sdf2 T C 11: 78,136,858 (GRCm39) S13P unknown Het
Selenbp1 A G 3: 94,847,079 (GRCm39) T202A probably benign Het
Slfn5 T C 11: 82,850,933 (GRCm39) F410S possibly damaging Het
Srrm2 A G 17: 24,039,880 (GRCm39) T2175A probably benign Het
St6galnac3 T C 3: 153,117,360 (GRCm39) Y121C possibly damaging Het
Stat1 A G 1: 52,184,337 (GRCm39) N417S probably benign Het
Tead1 T C 7: 112,475,378 (GRCm39) F276L probably damaging Het
Teddm3 A T 16: 20,971,737 (GRCm39) S277R probably benign Het
Tmc2 A G 2: 130,103,317 (GRCm39) probably null Het
Tmem156 G A 5: 65,231,127 (GRCm39) L248F probably damaging Het
Tnn T C 1: 159,953,986 (GRCm39) S590G probably benign Het
Trmt44 A G 5: 35,731,422 (GRCm39) probably null Het
Upp2 T A 2: 58,668,022 (GRCm39) Y238* probably null Het
Usp32 T C 11: 84,930,838 (GRCm39) T531A probably damaging Het
Vmn2r78 A T 7: 86,569,431 (GRCm39) D108V probably benign Het
Xylt1 T C 7: 117,255,870 (GRCm39) V814A probably benign Het
Zfy1 C T Y: 732,990 (GRCm39) R281H unknown Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 102,063,204 (GRCm39) critical splice donor site probably null
IGL00567:Wdfy3 APN 5 102,059,896 (GRCm39) splice site probably benign
IGL01288:Wdfy3 APN 5 102,049,857 (GRCm39) splice site probably null
IGL01323:Wdfy3 APN 5 102,042,930 (GRCm39) missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 102,091,986 (GRCm39) missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 102,047,897 (GRCm39) missense probably benign
IGL01560:Wdfy3 APN 5 102,105,352 (GRCm39) nonsense probably null
IGL01566:Wdfy3 APN 5 102,044,454 (GRCm39) splice site probably benign
IGL01616:Wdfy3 APN 5 102,061,126 (GRCm39) missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 102,055,354 (GRCm39) missense probably benign
IGL01791:Wdfy3 APN 5 102,085,278 (GRCm39) missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 102,071,947 (GRCm39) missense probably benign 0.11
IGL01953:Wdfy3 APN 5 102,042,894 (GRCm39) nonsense probably null
IGL02121:Wdfy3 APN 5 102,046,376 (GRCm39) missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 102,109,023 (GRCm39) missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 102,070,475 (GRCm39) missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 102,036,058 (GRCm39) missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 102,044,341 (GRCm39) missense probably benign 0.37
IGL02801:Wdfy3 APN 5 102,055,453 (GRCm39) missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 102,116,786 (GRCm39) missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 102,003,337 (GRCm39) missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 102,042,778 (GRCm39) missense probably null 1.00
IGL03064:Wdfy3 APN 5 102,083,863 (GRCm39) missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 102,014,142 (GRCm39) missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101,992,778 (GRCm39) splice site probably benign
IGL03237:Wdfy3 APN 5 101,992,465 (GRCm39) missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 102,048,016 (GRCm39) missense probably damaging 1.00
Esurient UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 102,077,847 (GRCm39) missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 102,030,827 (GRCm39) frame shift probably null
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101,992,912 (GRCm39) missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 102,037,161 (GRCm39) missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101,992,480 (GRCm39) missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 102,035,971 (GRCm39) missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0148:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0279:Wdfy3 UTSW 5 102,015,958 (GRCm39) missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 102,096,832 (GRCm39) missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 102,105,309 (GRCm39) missense probably benign 0.13
R0513:Wdfy3 UTSW 5 102,038,655 (GRCm39) missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 102,054,051 (GRCm39) missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101,984,038 (GRCm39) missense probably benign
R0787:Wdfy3 UTSW 5 102,105,254 (GRCm39) missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 102,017,917 (GRCm39) missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 102,030,832 (GRCm39) missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 102,023,797 (GRCm39) missense probably benign
R1350:Wdfy3 UTSW 5 102,046,418 (GRCm39) missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 102,032,080 (GRCm39) splice site probably benign
R1446:Wdfy3 UTSW 5 101,999,176 (GRCm39) missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 102,085,604 (GRCm39) missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 102,065,445 (GRCm39) missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101,991,947 (GRCm39) missense probably benign
R1633:Wdfy3 UTSW 5 102,129,414 (GRCm39) missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 102,023,781 (GRCm39) missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 102,089,313 (GRCm39) missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 102,074,391 (GRCm39) frame shift probably null
R1743:Wdfy3 UTSW 5 101,991,931 (GRCm39) missense probably benign 0.12
R1745:Wdfy3 UTSW 5 102,096,795 (GRCm39) missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 102,042,865 (GRCm39) missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 102,063,242 (GRCm39) missense probably benign 0.00
R1854:Wdfy3 UTSW 5 102,036,052 (GRCm39) missense probably benign 0.05
R1880:Wdfy3 UTSW 5 102,065,301 (GRCm39) missense probably benign 0.05
R1930:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 102,067,275 (GRCm39) missense probably benign 0.30
R1965:Wdfy3 UTSW 5 102,099,178 (GRCm39) missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 102,008,352 (GRCm39) missense probably null 1.00
R2087:Wdfy3 UTSW 5 102,042,926 (GRCm39) missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 102,046,291 (GRCm39) critical splice donor site probably null
R2192:Wdfy3 UTSW 5 102,055,408 (GRCm39) missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 102,037,150 (GRCm39) missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 102,036,189 (GRCm39) splice site probably benign
R2406:Wdfy3 UTSW 5 102,036,125 (GRCm39) missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 102,023,796 (GRCm39) missense probably benign 0.04
R2937:Wdfy3 UTSW 5 102,091,988 (GRCm39) missense probably benign 0.07
R3765:Wdfy3 UTSW 5 102,009,266 (GRCm39) missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 102,085,466 (GRCm39) missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 102,092,105 (GRCm39) nonsense probably null
R3947:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 102,071,961 (GRCm39) splice site probably benign
R4065:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4066:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4110:Wdfy3 UTSW 5 102,047,924 (GRCm39) critical splice donor site probably null
R4235:Wdfy3 UTSW 5 102,070,500 (GRCm39) critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 102,058,850 (GRCm39) missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 102,054,011 (GRCm39) missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 102,031,949 (GRCm39) missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 102,091,800 (GRCm39) missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 102,077,894 (GRCm39) missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 102,091,809 (GRCm39) missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 102,042,787 (GRCm39) missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 102,096,838 (GRCm39) nonsense probably null
R4973:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4976:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4984:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4986:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R5068:Wdfy3 UTSW 5 102,042,803 (GRCm39) missense probably benign 0.15
R5105:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 102,015,972 (GRCm39) missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101,997,133 (GRCm39) critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101,994,972 (GRCm39) missense probably null 0.03
R5303:Wdfy3 UTSW 5 102,100,849 (GRCm39) missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 102,020,724 (GRCm39) missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 102,067,312 (GRCm39) missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 102,044,425 (GRCm39) missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101,984,140 (GRCm39) missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 102,009,314 (GRCm39) missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 102,017,855 (GRCm39) missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 102,032,004 (GRCm39) missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101,999,225 (GRCm39) missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101,997,289 (GRCm39) missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 102,046,295 (GRCm39) missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 102,061,045 (GRCm39) missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 102,101,032 (GRCm39) missense probably benign 0.19
R6776:Wdfy3 UTSW 5 102,031,911 (GRCm39) missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 102,065,297 (GRCm39) nonsense probably null
R6809:Wdfy3 UTSW 5 102,071,813 (GRCm39) missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 102,100,865 (GRCm39) missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101,991,932 (GRCm39) missense probably benign 0.10
R7014:Wdfy3 UTSW 5 102,042,775 (GRCm39) critical splice donor site probably null
R7034:Wdfy3 UTSW 5 102,055,384 (GRCm39) missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 102,063,303 (GRCm39) missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 102,091,758 (GRCm39) missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 102,049,785 (GRCm39) missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101,984,074 (GRCm39) missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 102,003,389 (GRCm39) missense probably benign 0.02
R7418:Wdfy3 UTSW 5 102,105,366 (GRCm39) missense probably benign 0.08
R7533:Wdfy3 UTSW 5 102,030,354 (GRCm39) missense probably benign 0.27
R7543:Wdfy3 UTSW 5 102,083,925 (GRCm39) missense probably benign 0.00
R7625:Wdfy3 UTSW 5 102,003,252 (GRCm39) splice site probably null
R7788:Wdfy3 UTSW 5 101,996,223 (GRCm39) missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 102,099,265 (GRCm39) nonsense probably null
R7810:Wdfy3 UTSW 5 102,042,940 (GRCm39) missense probably benign 0.01
R8204:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.00
R8268:Wdfy3 UTSW 5 102,089,476 (GRCm39) missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 102,085,287 (GRCm39) missense probably benign
R8507:Wdfy3 UTSW 5 102,020,767 (GRCm39) missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101,999,219 (GRCm39) missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 102,033,064 (GRCm39) missense probably benign
R8710:Wdfy3 UTSW 5 102,030,349 (GRCm39) missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 102,077,951 (GRCm39) missense probably benign 0.00
R8749:Wdfy3 UTSW 5 102,030,446 (GRCm39) missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 102,065,421 (GRCm39) missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101,993,231 (GRCm39) intron probably benign
R8968:Wdfy3 UTSW 5 102,011,983 (GRCm39) missense probably benign 0.05
R8979:Wdfy3 UTSW 5 102,096,764 (GRCm39) missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101,993,058 (GRCm39) missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101,995,040 (GRCm39) missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.34
R9105:Wdfy3 UTSW 5 102,030,512 (GRCm39) missense probably benign 0.05
R9122:Wdfy3 UTSW 5 102,091,831 (GRCm39) missense probably damaging 1.00
R9249:Wdfy3 UTSW 5 101,996,359 (GRCm39) missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 102,000,478 (GRCm39) missense probably benign 0.19
R9490:Wdfy3 UTSW 5 102,078,716 (GRCm39) missense probably benign 0.29
R9524:Wdfy3 UTSW 5 102,055,333 (GRCm39) missense probably benign 0.03
R9545:Wdfy3 UTSW 5 102,100,957 (GRCm39) missense
R9548:Wdfy3 UTSW 5 102,033,059 (GRCm39) missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 102,047,899 (GRCm39) missense probably benign
R9750:Wdfy3 UTSW 5 102,077,960 (GRCm39) missense probably benign 0.00
R9766:Wdfy3 UTSW 5 102,042,866 (GRCm39) missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 102,000,195 (GRCm39) missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 102,048,107 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CGGTCCCTTCATTCACTAAACAG -3'
(R):5'- TAAACCTGTCATCCAGCAGGTC -3'

Sequencing Primer
(F):5'- GAGAGATACCAAGACGCAGCTTAC -3'
(R):5'- GTAACTCCCTGAATTTCAAGGC -3'
Posted On 2022-02-07