Incidental Mutation 'R9209:Cntnap2'
ID 698706
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47026183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 944 (G944E)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: G944E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: G944E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150737
AA Change: G3E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419
AA Change: G3E

DomainStartEndE-ValueType
EGF 25 61 1e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,837 (GRCm39) N513K possibly damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts5 A G 16: 85,666,971 (GRCm39) V507A probably damaging Het
Ap3d1 A G 10: 80,554,918 (GRCm39) V469A probably benign Het
Arhgef4 G T 1: 34,764,241 (GRCm39) probably null Het
Arhgef4 A T 1: 34,849,576 (GRCm39) Q389L probably benign Het
Atad2 A G 15: 57,980,194 (GRCm39) V106A possibly damaging Het
Azin2 T C 4: 128,841,341 (GRCm39) E275G probably damaging Het
Bhlhe23 A G 2: 180,418,143 (GRCm39) S132P probably damaging Het
Capn12 A G 7: 28,581,243 (GRCm39) Y32C probably damaging Het
Celsr2 A T 3: 108,321,349 (GRCm39) S488T probably benign Het
Cenpx A G 11: 120,602,582 (GRCm39) V27A possibly damaging Het
Clca3a2 G A 3: 144,778,005 (GRCm39) P760L probably benign Het
Clstn3 T C 6: 124,408,571 (GRCm39) S951G probably benign Het
Clybl C A 14: 122,621,670 (GRCm39) P286Q probably benign Het
Cmya5 T A 13: 93,226,866 (GRCm39) M2741L probably benign Het
Col8a1 A C 16: 57,447,283 (GRCm39) Y742* probably null Het
Crb1 T C 1: 139,171,051 (GRCm39) K780E probably damaging Het
Crygc T A 1: 65,112,376 (GRCm39) Y66F probably benign Het
Cyp2b9 G A 7: 25,873,004 (GRCm39) G49E possibly damaging Het
D130043K22Rik T C 13: 25,041,090 (GRCm39) S171P possibly damaging Het
Dhx36 T C 3: 62,378,895 (GRCm39) I890V probably benign Het
Dpp9 C T 17: 56,512,765 (GRCm39) G148S probably damaging Het
Eml6 G T 11: 29,781,175 (GRCm39) S619Y probably damaging Het
Enpp4 A T 17: 44,412,252 (GRCm39) L319* probably null Het
Esyt1 T C 10: 128,361,356 (GRCm39) S113G probably benign Het
Fat1 A G 8: 45,404,791 (GRCm39) D514G possibly damaging Het
Fbxo16 G A 14: 65,524,594 (GRCm39) R38Q probably damaging Het
Fchsd1 A T 18: 38,092,706 (GRCm39) M668K unknown Het
Gpr149 C T 3: 62,511,093 (GRCm39) S302N probably benign Het
Gsap A G 5: 21,433,064 (GRCm39) K258E probably benign Het
Helq C A 5: 100,939,218 (GRCm39) V443F probably benign Het
Helq T A 5: 100,939,219 (GRCm39) K442N probably damaging Het
Ighv1-37 T C 12: 114,860,123 (GRCm39) E29G possibly damaging Het
Ighv1-9 C A 12: 114,547,620 (GRCm39) M1I probably null Het
Itga6 T G 2: 71,671,477 (GRCm39) F743V probably benign Het
Lpin1 C A 12: 16,588,548 (GRCm39) D881Y Het
Lypd8 T A 11: 58,273,640 (GRCm39) C40S possibly damaging Het
Macf1 C T 4: 123,326,227 (GRCm39) R5092Q probably damaging Het
Mcm7 A G 5: 138,166,593 (GRCm39) probably null Het
Micall2 G A 5: 139,696,170 (GRCm39) T831I unknown Het
Myo18b A T 5: 113,022,927 (GRCm39) M155K unknown Het
Nckap5 T A 1: 125,867,928 (GRCm39) H201L unknown Het
Ndst2 A T 14: 20,779,240 (GRCm39) D333E possibly damaging Het
Nlgn1 A G 3: 25,966,804 (GRCm39) probably null Het
Nup188 T G 2: 30,232,397 (GRCm39) Y1483D probably benign Het
Or4c109 A C 2: 88,818,057 (GRCm39) L163* probably null Het
Or52ae9 T A 7: 103,390,319 (GRCm39) S43C probably benign Het
Or52n4b A C 7: 108,144,664 (GRCm39) I311L probably benign Het
Or5p66 T A 7: 107,885,526 (GRCm39) Y269F probably benign Het
Or8g33 T A 9: 39,337,635 (GRCm39) H244L probably damaging Het
Peg3 A C 7: 6,711,226 (GRCm39) I1332S possibly damaging Het
Piezo2 T C 18: 63,154,372 (GRCm39) K2469R probably damaging Het
Pik3cg T C 12: 32,247,312 (GRCm39) M804V probably damaging Het
Polq A T 16: 36,869,011 (GRCm39) I794F possibly damaging Het
Rasgef1b A G 5: 99,370,191 (GRCm39) V437A probably benign Het
Rdm1 T A 11: 101,518,857 (GRCm39) D21E probably benign Het
Ripk4 G T 16: 97,551,311 (GRCm39) Q219K possibly damaging Het
Ropn1l T C 15: 31,441,471 (GRCm39) I217V Het
Sdf2 T C 11: 78,136,858 (GRCm39) S13P unknown Het
Selenbp1 A G 3: 94,847,079 (GRCm39) T202A probably benign Het
Slfn5 T C 11: 82,850,933 (GRCm39) F410S possibly damaging Het
Srrm2 A G 17: 24,039,880 (GRCm39) T2175A probably benign Het
St6galnac3 T C 3: 153,117,360 (GRCm39) Y121C possibly damaging Het
Stat1 A G 1: 52,184,337 (GRCm39) N417S probably benign Het
Tead1 T C 7: 112,475,378 (GRCm39) F276L probably damaging Het
Teddm3 A T 16: 20,971,737 (GRCm39) S277R probably benign Het
Tmc2 A G 2: 130,103,317 (GRCm39) probably null Het
Tmem156 G A 5: 65,231,127 (GRCm39) L248F probably damaging Het
Tnn T C 1: 159,953,986 (GRCm39) S590G probably benign Het
Trmt44 A G 5: 35,731,422 (GRCm39) probably null Het
Upp2 T A 2: 58,668,022 (GRCm39) Y238* probably null Het
Usp32 T C 11: 84,930,838 (GRCm39) T531A probably damaging Het
Vmn2r78 A T 7: 86,569,431 (GRCm39) D108V probably benign Het
Wdfy3 G T 5: 102,078,830 (GRCm39) A824E probably benign Het
Xylt1 T C 7: 117,255,870 (GRCm39) V814A probably benign Het
Zfy1 C T Y: 732,990 (GRCm39) R281H unknown Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACAGCCTAAGGGAAAAGCTTC -3'
(R):5'- TTGCAGAATGTCCCATCATAGGC -3'

Sequencing Primer
(F):5'- GGGAAAAGCTTCAACTCTCTCTG -3'
(R):5'- CCCATCATAGGCTGTGTTAGAGCAG -3'
Posted On 2022-02-07