Incidental Mutation 'R9209:Cntnap2'
ID 698706
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47049249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 944 (G944E)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: G944E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: G944E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150737
AA Change: G3E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419
AA Change: G3E

DomainStartEndE-ValueType
EGF 25 61 1e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,413 N513K possibly damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts5 A G 16: 85,870,083 V507A probably damaging Het
Ap3d1 A G 10: 80,719,084 V469A probably benign Het
Arhgef4 G T 1: 34,725,160 probably null Het
Arhgef4 A T 1: 34,810,495 Q389L probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Azin2 T C 4: 128,947,548 E275G probably damaging Het
Bhlhe23 A G 2: 180,776,350 S132P probably damaging Het
Capn12 A G 7: 28,881,818 Y32C probably damaging Het
Celsr2 A T 3: 108,414,033 S488T probably benign Het
Cenpx A G 11: 120,711,756 V27A possibly damaging Het
Clca2 G A 3: 145,072,244 P760L probably benign Het
Clstn3 T C 6: 124,431,612 S951G probably benign Het
Clybl C A 14: 122,384,258 P286Q probably benign Het
Cmya5 T A 13: 93,090,358 M2741L probably benign Het
Col8a1 A C 16: 57,626,920 Y742* probably null Het
Crb1 T C 1: 139,243,313 K780E probably damaging Het
Crygc T A 1: 65,073,217 Y66F probably benign Het
Cyp2b9 G A 7: 26,173,579 G49E possibly damaging Het
D130043K22Rik T C 13: 24,857,107 S171P possibly damaging Het
Dhx36 T C 3: 62,471,474 I890V probably benign Het
Dpp9 C T 17: 56,205,765 G148S probably damaging Het
Eml6 G T 11: 29,831,175 S619Y probably damaging Het
Enpp4 A T 17: 44,101,361 L319* probably null Het
Esyt1 T C 10: 128,525,487 S113G probably benign Het
Fat1 A G 8: 44,951,754 D514G possibly damaging Het
Fbxo16 G A 14: 65,287,145 R38Q probably damaging Het
Fchsd1 A T 18: 37,959,653 M668K unknown Het
Gpr149 C T 3: 62,603,672 S302N probably benign Het
Gsap A G 5: 21,228,066 K258E probably benign Het
Helq C A 5: 100,791,352 V443F probably benign Het
Helq T A 5: 100,791,353 K442N probably damaging Het
Ighv1-37 T C 12: 114,896,503 E29G possibly damaging Het
Ighv1-9 C A 12: 114,584,000 M1I probably null Het
Itga6 T G 2: 71,841,133 F743V probably benign Het
Lpin1 C A 12: 16,538,547 D881Y Het
Lypd8 T A 11: 58,382,814 C40S possibly damaging Het
Macf1 C T 4: 123,432,434 R5092Q probably damaging Het
Mcm7 A G 5: 138,168,331 probably null Het
Micall2 G A 5: 139,710,415 T831I unknown Het
Myo18b A T 5: 112,875,061 M155K unknown Het
Nckap5 T A 1: 125,940,191 H201L unknown Het
Ndst2 A T 14: 20,729,172 D333E possibly damaging Het
Nlgn1 A G 3: 25,912,640 probably null Het
Nup188 T G 2: 30,342,385 Y1483D probably benign Het
Olfr1214 A C 2: 88,987,713 L163* probably null Het
Olfr490 T A 7: 108,286,319 Y269F probably benign Het
Olfr503 A C 7: 108,545,457 I311L probably benign Het
Olfr629 T A 7: 103,741,112 S43C probably benign Het
Olfr952 T A 9: 39,426,339 H244L probably damaging Het
Peg3 A C 7: 6,708,227 I1332S possibly damaging Het
Piezo2 T C 18: 63,021,301 K2469R probably damaging Het
Pik3cg T C 12: 32,197,313 M804V probably damaging Het
Polq A T 16: 37,048,649 I794F possibly damaging Het
Rasgef1b A G 5: 99,222,332 V437A probably benign Het
Rdm1 T A 11: 101,628,031 D21E probably benign Het
Ripk4 G T 16: 97,750,111 Q219K possibly damaging Het
Ropn1l T C 15: 31,441,325 I217V Het
Sdf2 T C 11: 78,246,032 S13P unknown Het
Selenbp1 A G 3: 94,939,768 T202A probably benign Het
Slfn5 T C 11: 82,960,107 F410S possibly damaging Het
Srrm2 A G 17: 23,820,906 T2175A probably benign Het
St6galnac3 T C 3: 153,411,723 Y121C possibly damaging Het
Stat1 A G 1: 52,145,178 N417S probably benign Het
Tead1 T C 7: 112,876,171 F276L probably damaging Het
Teddm3 A T 16: 21,152,987 S277R probably benign Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmem156 G A 5: 65,073,784 L248F probably damaging Het
Tnn T C 1: 160,126,416 S590G probably benign Het
Trmt44 A G 5: 35,574,078 probably null Het
Upp2 T A 2: 58,778,010 Y238* probably null Het
Usp32 T C 11: 85,040,012 T531A probably damaging Het
Vmn2r78 A T 7: 86,920,223 D108V probably benign Het
Wdfy3 G T 5: 101,930,964 A824E probably benign Het
Xylt1 T C 7: 117,656,647 V814A probably benign Het
Zfy1 C T Y: 732,990 R281H unknown Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACAGCCTAAGGGAAAAGCTTC -3'
(R):5'- TTGCAGAATGTCCCATCATAGGC -3'

Sequencing Primer
(F):5'- GGGAAAAGCTTCAACTCTCTCTG -3'
(R):5'- CCCATCATAGGCTGTGTTAGAGCAG -3'
Posted On 2022-02-07