Incidental Mutation 'R9209:Vmn2r78'
ID 698712
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86915300-86955177 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86920223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 108 (D108V)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably benign
Transcript: ENSMUST00000170835
AA Change: D108V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: D108V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (73/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,413 N513K possibly damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts5 A G 16: 85,870,083 V507A probably damaging Het
Ap3d1 A G 10: 80,719,084 V469A probably benign Het
Arhgef4 G T 1: 34,725,160 probably null Het
Arhgef4 A T 1: 34,810,495 Q389L probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Azin2 T C 4: 128,947,548 E275G probably damaging Het
Bhlhe23 A G 2: 180,776,350 S132P probably damaging Het
Capn12 A G 7: 28,881,818 Y32C probably damaging Het
Celsr2 A T 3: 108,414,033 S488T probably benign Het
Cenpx A G 11: 120,711,756 V27A possibly damaging Het
Clca2 G A 3: 145,072,244 P760L probably benign Het
Clstn3 T C 6: 124,431,612 S951G probably benign Het
Clybl C A 14: 122,384,258 P286Q probably benign Het
Cmya5 T A 13: 93,090,358 M2741L probably benign Het
Cntnap2 G A 6: 47,049,249 G944E probably damaging Het
Col8a1 A C 16: 57,626,920 Y742* probably null Het
Crb1 T C 1: 139,243,313 K780E probably damaging Het
Crygc T A 1: 65,073,217 Y66F probably benign Het
Cyp2b9 G A 7: 26,173,579 G49E possibly damaging Het
D130043K22Rik T C 13: 24,857,107 S171P possibly damaging Het
Dhx36 T C 3: 62,471,474 I890V probably benign Het
Dpp9 C T 17: 56,205,765 G148S probably damaging Het
Eml6 G T 11: 29,831,175 S619Y probably damaging Het
Enpp4 A T 17: 44,101,361 L319* probably null Het
Esyt1 T C 10: 128,525,487 S113G probably benign Het
Fat1 A G 8: 44,951,754 D514G possibly damaging Het
Fbxo16 G A 14: 65,287,145 R38Q probably damaging Het
Fchsd1 A T 18: 37,959,653 M668K unknown Het
Gpr149 C T 3: 62,603,672 S302N probably benign Het
Gsap A G 5: 21,228,066 K258E probably benign Het
Helq C A 5: 100,791,352 V443F probably benign Het
Helq T A 5: 100,791,353 K442N probably damaging Het
Ighv1-37 T C 12: 114,896,503 E29G possibly damaging Het
Ighv1-9 C A 12: 114,584,000 M1I probably null Het
Itga6 T G 2: 71,841,133 F743V probably benign Het
Lpin1 C A 12: 16,538,547 D881Y Het
Lypd8 T A 11: 58,382,814 C40S possibly damaging Het
Macf1 C T 4: 123,432,434 R5092Q probably damaging Het
Mcm7 A G 5: 138,168,331 probably null Het
Micall2 G A 5: 139,710,415 T831I unknown Het
Myo18b A T 5: 112,875,061 M155K unknown Het
Nckap5 T A 1: 125,940,191 H201L unknown Het
Ndst2 A T 14: 20,729,172 D333E possibly damaging Het
Nlgn1 A G 3: 25,912,640 probably null Het
Nup188 T G 2: 30,342,385 Y1483D probably benign Het
Olfr1214 A C 2: 88,987,713 L163* probably null Het
Olfr490 T A 7: 108,286,319 Y269F probably benign Het
Olfr503 A C 7: 108,545,457 I311L probably benign Het
Olfr629 T A 7: 103,741,112 S43C probably benign Het
Olfr952 T A 9: 39,426,339 H244L probably damaging Het
Peg3 A C 7: 6,708,227 I1332S possibly damaging Het
Piezo2 T C 18: 63,021,301 K2469R probably damaging Het
Pik3cg T C 12: 32,197,313 M804V probably damaging Het
Polq A T 16: 37,048,649 I794F possibly damaging Het
Rasgef1b A G 5: 99,222,332 V437A probably benign Het
Rdm1 T A 11: 101,628,031 D21E probably benign Het
Ripk4 G T 16: 97,750,111 Q219K possibly damaging Het
Ropn1l T C 15: 31,441,325 I217V Het
Sdf2 T C 11: 78,246,032 S13P unknown Het
Selenbp1 A G 3: 94,939,768 T202A probably benign Het
Slfn5 T C 11: 82,960,107 F410S possibly damaging Het
Srrm2 A G 17: 23,820,906 T2175A probably benign Het
St6galnac3 T C 3: 153,411,723 Y121C possibly damaging Het
Stat1 A G 1: 52,145,178 N417S probably benign Het
Tead1 T C 7: 112,876,171 F276L probably damaging Het
Teddm3 A T 16: 21,152,987 S277R probably benign Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmem156 G A 5: 65,073,784 L248F probably damaging Het
Tnn T C 1: 160,126,416 S590G probably benign Het
Trmt44 A G 5: 35,574,078 probably null Het
Upp2 T A 2: 58,778,010 Y238* probably null Het
Usp32 T C 11: 85,040,012 T531A probably damaging Het
Wdfy3 G T 5: 101,930,964 A824E probably benign Het
Xylt1 T C 7: 117,656,647 V814A probably benign Het
Zfy1 C T Y: 732,990 R281H unknown Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGTGTCAACATATGAATGGGTCAC -3'
(R):5'- AAATGTAACCCTCTCTGACTTACC -3'

Sequencing Primer
(F):5'- AAAAATCTTTGCTTAACCCACAATG -3'
(R):5'- ACCTCTGGAGTTTGGGAGAAGTAC -3'
Posted On 2022-02-07