Incidental Mutation 'R9209:Cmya5'
ID 698734
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E16Rik, 2310076E21Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 93177221-93281232 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93226866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 2741 (M2741L)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: M2741L

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: M2741L

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (73/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,837 (GRCm39) N513K possibly damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts5 A G 16: 85,666,971 (GRCm39) V507A probably damaging Het
Ap3d1 A G 10: 80,554,918 (GRCm39) V469A probably benign Het
Arhgef4 G T 1: 34,764,241 (GRCm39) probably null Het
Arhgef4 A T 1: 34,849,576 (GRCm39) Q389L probably benign Het
Atad2 A G 15: 57,980,194 (GRCm39) V106A possibly damaging Het
Azin2 T C 4: 128,841,341 (GRCm39) E275G probably damaging Het
Bhlhe23 A G 2: 180,418,143 (GRCm39) S132P probably damaging Het
Capn12 A G 7: 28,581,243 (GRCm39) Y32C probably damaging Het
Celsr2 A T 3: 108,321,349 (GRCm39) S488T probably benign Het
Cenpx A G 11: 120,602,582 (GRCm39) V27A possibly damaging Het
Clca3a2 G A 3: 144,778,005 (GRCm39) P760L probably benign Het
Clstn3 T C 6: 124,408,571 (GRCm39) S951G probably benign Het
Clybl C A 14: 122,621,670 (GRCm39) P286Q probably benign Het
Cntnap2 G A 6: 47,026,183 (GRCm39) G944E probably damaging Het
Col8a1 A C 16: 57,447,283 (GRCm39) Y742* probably null Het
Crb1 T C 1: 139,171,051 (GRCm39) K780E probably damaging Het
Crygc T A 1: 65,112,376 (GRCm39) Y66F probably benign Het
Cyp2b9 G A 7: 25,873,004 (GRCm39) G49E possibly damaging Het
D130043K22Rik T C 13: 25,041,090 (GRCm39) S171P possibly damaging Het
Dhx36 T C 3: 62,378,895 (GRCm39) I890V probably benign Het
Dpp9 C T 17: 56,512,765 (GRCm39) G148S probably damaging Het
Eml6 G T 11: 29,781,175 (GRCm39) S619Y probably damaging Het
Enpp4 A T 17: 44,412,252 (GRCm39) L319* probably null Het
Esyt1 T C 10: 128,361,356 (GRCm39) S113G probably benign Het
Fat1 A G 8: 45,404,791 (GRCm39) D514G possibly damaging Het
Fbxo16 G A 14: 65,524,594 (GRCm39) R38Q probably damaging Het
Fchsd1 A T 18: 38,092,706 (GRCm39) M668K unknown Het
Gpr149 C T 3: 62,511,093 (GRCm39) S302N probably benign Het
Gsap A G 5: 21,433,064 (GRCm39) K258E probably benign Het
Helq C A 5: 100,939,218 (GRCm39) V443F probably benign Het
Helq T A 5: 100,939,219 (GRCm39) K442N probably damaging Het
Ighv1-37 T C 12: 114,860,123 (GRCm39) E29G possibly damaging Het
Ighv1-9 C A 12: 114,547,620 (GRCm39) M1I probably null Het
Itga6 T G 2: 71,671,477 (GRCm39) F743V probably benign Het
Lpin1 C A 12: 16,588,548 (GRCm39) D881Y Het
Lypd8 T A 11: 58,273,640 (GRCm39) C40S possibly damaging Het
Macf1 C T 4: 123,326,227 (GRCm39) R5092Q probably damaging Het
Mcm7 A G 5: 138,166,593 (GRCm39) probably null Het
Micall2 G A 5: 139,696,170 (GRCm39) T831I unknown Het
Myo18b A T 5: 113,022,927 (GRCm39) M155K unknown Het
Nckap5 T A 1: 125,867,928 (GRCm39) H201L unknown Het
Ndst2 A T 14: 20,779,240 (GRCm39) D333E possibly damaging Het
Nlgn1 A G 3: 25,966,804 (GRCm39) probably null Het
Nup188 T G 2: 30,232,397 (GRCm39) Y1483D probably benign Het
Or4c109 A C 2: 88,818,057 (GRCm39) L163* probably null Het
Or52ae9 T A 7: 103,390,319 (GRCm39) S43C probably benign Het
Or52n4b A C 7: 108,144,664 (GRCm39) I311L probably benign Het
Or5p66 T A 7: 107,885,526 (GRCm39) Y269F probably benign Het
Or8g33 T A 9: 39,337,635 (GRCm39) H244L probably damaging Het
Peg3 A C 7: 6,711,226 (GRCm39) I1332S possibly damaging Het
Piezo2 T C 18: 63,154,372 (GRCm39) K2469R probably damaging Het
Pik3cg T C 12: 32,247,312 (GRCm39) M804V probably damaging Het
Polq A T 16: 36,869,011 (GRCm39) I794F possibly damaging Het
Rasgef1b A G 5: 99,370,191 (GRCm39) V437A probably benign Het
Rdm1 T A 11: 101,518,857 (GRCm39) D21E probably benign Het
Ripk4 G T 16: 97,551,311 (GRCm39) Q219K possibly damaging Het
Ropn1l T C 15: 31,441,471 (GRCm39) I217V Het
Sdf2 T C 11: 78,136,858 (GRCm39) S13P unknown Het
Selenbp1 A G 3: 94,847,079 (GRCm39) T202A probably benign Het
Slfn5 T C 11: 82,850,933 (GRCm39) F410S possibly damaging Het
Srrm2 A G 17: 24,039,880 (GRCm39) T2175A probably benign Het
St6galnac3 T C 3: 153,117,360 (GRCm39) Y121C possibly damaging Het
Stat1 A G 1: 52,184,337 (GRCm39) N417S probably benign Het
Tead1 T C 7: 112,475,378 (GRCm39) F276L probably damaging Het
Teddm3 A T 16: 20,971,737 (GRCm39) S277R probably benign Het
Tmc2 A G 2: 130,103,317 (GRCm39) probably null Het
Tmem156 G A 5: 65,231,127 (GRCm39) L248F probably damaging Het
Tnn T C 1: 159,953,986 (GRCm39) S590G probably benign Het
Trmt44 A G 5: 35,731,422 (GRCm39) probably null Het
Upp2 T A 2: 58,668,022 (GRCm39) Y238* probably null Het
Usp32 T C 11: 84,930,838 (GRCm39) T531A probably damaging Het
Vmn2r78 A T 7: 86,569,431 (GRCm39) D108V probably benign Het
Wdfy3 G T 5: 102,078,830 (GRCm39) A824E probably benign Het
Xylt1 T C 7: 117,255,870 (GRCm39) V814A probably benign Het
Zfy1 C T Y: 732,990 (GRCm39) R281H unknown Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93,229,628 (GRCm39) missense probably benign 0.13
IGL00516:Cmya5 APN 13 93,234,675 (GRCm39) missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93,230,669 (GRCm39) missense probably benign 0.00
IGL00948:Cmya5 APN 13 93,227,544 (GRCm39) missense probably benign
IGL00966:Cmya5 APN 13 93,234,414 (GRCm39) missense probably benign 0.33
IGL00988:Cmya5 APN 13 93,234,441 (GRCm39) missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93,221,120 (GRCm39) missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93,233,454 (GRCm39) missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93,225,714 (GRCm39) missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93,230,535 (GRCm39) missense probably benign
IGL01679:Cmya5 APN 13 93,201,828 (GRCm39) missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93,225,807 (GRCm39) missense probably benign 0.00
IGL01861:Cmya5 APN 13 93,226,256 (GRCm39) missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93,231,057 (GRCm39) missense probably benign 0.00
IGL02034:Cmya5 APN 13 93,221,043 (GRCm39) splice site probably benign
IGL02103:Cmya5 APN 13 93,228,635 (GRCm39) missense probably benign 0.05
IGL02174:Cmya5 APN 13 93,185,415 (GRCm39) missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93,226,658 (GRCm39) missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93,229,242 (GRCm39) missense probably benign 0.14
IGL02229:Cmya5 APN 13 93,229,194 (GRCm39) missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93,234,527 (GRCm39) missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93,227,163 (GRCm39) missense probably benign 0.40
IGL02409:Cmya5 APN 13 93,226,706 (GRCm39) missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93,228,366 (GRCm39) missense probably benign 0.00
IGL02676:Cmya5 APN 13 93,229,361 (GRCm39) missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02685:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02686:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02724:Cmya5 APN 13 93,233,163 (GRCm39) missense probably benign
IGL02727:Cmya5 APN 13 93,234,753 (GRCm39) missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93,229,065 (GRCm39) missense probably benign 0.41
IGL03079:Cmya5 APN 13 93,234,209 (GRCm39) missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93,227,376 (GRCm39) missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93,227,778 (GRCm39) nonsense probably null
IGL03336:Cmya5 APN 13 93,230,013 (GRCm39) missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93,201,850 (GRCm39) missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93,225,854 (GRCm39) missense probably benign 0.22
P4748:Cmya5 UTSW 13 93,210,983 (GRCm39) splice site probably benign
R0123:Cmya5 UTSW 13 93,232,412 (GRCm39) missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0331:Cmya5 UTSW 13 93,280,911 (GRCm39) missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93,231,377 (GRCm39) missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93,229,256 (GRCm39) missense probably benign 0.06
R0416:Cmya5 UTSW 13 93,226,364 (GRCm39) missense probably benign 0.05
R0446:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R0457:Cmya5 UTSW 13 93,232,095 (GRCm39) missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93,226,505 (GRCm39) missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93,229,299 (GRCm39) missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93,230,357 (GRCm39) nonsense probably null
R0698:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93,230,954 (GRCm39) missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93,231,620 (GRCm39) missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93,178,043 (GRCm39) missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93,178,033 (GRCm39) missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93,228,566 (GRCm39) missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93,201,835 (GRCm39) missense probably benign 0.44
R1572:Cmya5 UTSW 13 93,230,777 (GRCm39) missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93,200,027 (GRCm39) missense probably benign 0.27
R1735:Cmya5 UTSW 13 93,226,297 (GRCm39) missense probably benign 0.11
R1743:Cmya5 UTSW 13 93,233,825 (GRCm39) missense probably benign 0.33
R1750:Cmya5 UTSW 13 93,232,171 (GRCm39) missense probably benign
R1827:Cmya5 UTSW 13 93,210,956 (GRCm39) missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93,227,032 (GRCm39) missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93,229,320 (GRCm39) missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93,205,891 (GRCm39) missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93,230,003 (GRCm39) missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93,230,210 (GRCm39) missense probably benign 0.15
R2497:Cmya5 UTSW 13 93,234,513 (GRCm39) missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93,230,066 (GRCm39) missense probably benign 0.41
R2917:Cmya5 UTSW 13 93,227,572 (GRCm39) nonsense probably null
R2944:Cmya5 UTSW 13 93,229,350 (GRCm39) nonsense probably null
R3039:Cmya5 UTSW 13 93,228,758 (GRCm39) missense probably benign 0.12
R3078:Cmya5 UTSW 13 93,185,435 (GRCm39) missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93,231,874 (GRCm39) nonsense probably null
R3717:Cmya5 UTSW 13 93,228,995 (GRCm39) missense probably benign 0.12
R3768:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93,227,727 (GRCm39) missense probably benign 0.07
R3888:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R3897:Cmya5 UTSW 13 93,233,189 (GRCm39) missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93,225,707 (GRCm39) missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93,228,464 (GRCm39) missense probably benign 0.36
R4471:Cmya5 UTSW 13 93,228,833 (GRCm39) missense probably benign 0.01
R4493:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4495:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4544:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4545:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4624:Cmya5 UTSW 13 93,200,059 (GRCm39) missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93,230,082 (GRCm39) missense probably benign 0.04
R4965:Cmya5 UTSW 13 93,232,295 (GRCm39) missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93,227,093 (GRCm39) missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93,228,111 (GRCm39) missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93,229,880 (GRCm39) missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93,232,569 (GRCm39) missense probably benign 0.00
R5220:Cmya5 UTSW 13 93,228,804 (GRCm39) missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93,232,703 (GRCm39) missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93,219,781 (GRCm39) missense probably benign 0.28
R5356:Cmya5 UTSW 13 93,199,993 (GRCm39) missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93,228,476 (GRCm39) missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93,231,707 (GRCm39) missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93,229,271 (GRCm39) missense probably benign 0.15
R5628:Cmya5 UTSW 13 93,226,218 (GRCm39) missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93,182,457 (GRCm39) missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93,234,684 (GRCm39) missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93,182,374 (GRCm39) critical splice donor site probably null
R5806:Cmya5 UTSW 13 93,230,445 (GRCm39) missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93,229,288 (GRCm39) missense probably benign 0.04
R5872:Cmya5 UTSW 13 93,233,943 (GRCm39) missense probably benign 0.01
R5875:Cmya5 UTSW 13 93,231,692 (GRCm39) missense probably benign 0.13
R5896:Cmya5 UTSW 13 93,182,373 (GRCm39) critical splice donor site probably null
R5910:Cmya5 UTSW 13 93,229,151 (GRCm39) missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93,226,052 (GRCm39) missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93,226,157 (GRCm39) missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93,281,021 (GRCm39) unclassified probably benign
R6102:Cmya5 UTSW 13 93,230,739 (GRCm39) missense probably benign
R6117:Cmya5 UTSW 13 93,231,674 (GRCm39) missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93,233,784 (GRCm39) missense possibly damaging 0.73
R6188:Cmya5 UTSW 13 93,229,952 (GRCm39) missense possibly damaging 0.61
R6219:Cmya5 UTSW 13 93,230,951 (GRCm39) missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93,229,814 (GRCm39) missense probably benign 0.41
R6346:Cmya5 UTSW 13 93,228,698 (GRCm39) missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93,210,972 (GRCm39) missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93,225,723 (GRCm39) missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93,226,316 (GRCm39) missense probably benign 0.05
R6649:Cmya5 UTSW 13 93,234,533 (GRCm39) missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93,229,547 (GRCm39) missense probably damaging 0.99
R6652:Cmya5 UTSW 13 93,229,403 (GRCm39) missense probably benign 0.04
R6669:Cmya5 UTSW 13 93,229,767 (GRCm39) missense probably benign 0.03
R6881:Cmya5 UTSW 13 93,226,800 (GRCm39) missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93,227,760 (GRCm39) missense probably benign 0.04
R6933:Cmya5 UTSW 13 93,231,644 (GRCm39) missense probably benign 0.03
R7021:Cmya5 UTSW 13 93,230,063 (GRCm39) missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93,205,786 (GRCm39) critical splice donor site probably null
R7068:Cmya5 UTSW 13 93,229,205 (GRCm39) missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93,227,483 (GRCm39) missense probably benign 0.00
R7088:Cmya5 UTSW 13 93,228,372 (GRCm39) missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93,226,448 (GRCm39) missense probably benign 0.41
R7177:Cmya5 UTSW 13 93,231,836 (GRCm39) missense probably benign 0.00
R7188:Cmya5 UTSW 13 93,182,546 (GRCm39) missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93,226,938 (GRCm39) missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93,232,208 (GRCm39) missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93,229,305 (GRCm39) missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93,229,061 (GRCm39) missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93,228,169 (GRCm39) missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93,205,831 (GRCm39) missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93,228,346 (GRCm39) missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93,233,942 (GRCm39) missense probably benign 0.02
R7552:Cmya5 UTSW 13 93,205,820 (GRCm39) missense probably benign 0.41
R7624:Cmya5 UTSW 13 93,226,865 (GRCm39) missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93,219,720 (GRCm39) missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93,230,629 (GRCm39) missense probably benign 0.13
R7753:Cmya5 UTSW 13 93,234,680 (GRCm39) missense probably benign 0.18
R7757:Cmya5 UTSW 13 93,234,780 (GRCm39) missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93,230,770 (GRCm39) missense probably benign 0.00
R7825:Cmya5 UTSW 13 93,234,136 (GRCm39) missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93,226,265 (GRCm39) missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93,232,865 (GRCm39) missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93,233,512 (GRCm39) small deletion probably benign
R8127:Cmya5 UTSW 13 93,231,122 (GRCm39) missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93,229,986 (GRCm39) missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93,228,142 (GRCm39) nonsense probably null
R8446:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93,230,304 (GRCm39) missense probably benign 0.00
R8686:Cmya5 UTSW 13 93,231,888 (GRCm39) missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93,226,229 (GRCm39) missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93,225,888 (GRCm39) missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93,177,991 (GRCm39) missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93,200,048 (GRCm39) missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93,232,840 (GRCm39) missense probably benign 0.01
R8985:Cmya5 UTSW 13 93,233,664 (GRCm39) missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93,228,572 (GRCm39) missense probably benign 0.03
R9087:Cmya5 UTSW 13 93,233,711 (GRCm39) missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93,234,108 (GRCm39) missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93,233,878 (GRCm39) missense unknown
R9222:Cmya5 UTSW 13 93,230,579 (GRCm39) missense probably benign 0.00
R9229:Cmya5 UTSW 13 93,232,176 (GRCm39) missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93,229,884 (GRCm39) missense probably benign
R9385:Cmya5 UTSW 13 93,230,880 (GRCm39) missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93,226,209 (GRCm39) missense probably benign 0.22
R9452:Cmya5 UTSW 13 93,232,394 (GRCm39) missense probably benign
R9492:Cmya5 UTSW 13 93,177,822 (GRCm39) makesense probably null
R9600:Cmya5 UTSW 13 93,226,604 (GRCm39) missense probably damaging 1.00
R9712:Cmya5 UTSW 13 93,201,881 (GRCm39) critical splice acceptor site probably null
R9742:Cmya5 UTSW 13 93,231,935 (GRCm39) missense possibly damaging 0.89
RF020:Cmya5 UTSW 13 93,205,799 (GRCm39) missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93,233,195 (GRCm39) missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1176:Cmya5 UTSW 13 93,233,298 (GRCm39) missense unknown
Z1176:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1177:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTAGCAGCTCAGGGTTGACAG -3'
(R):5'- ACCCACAGTTTCTGGTGAAGAG -3'

Sequencing Primer
(F):5'- GTTGACAGCCTTGGGGG -3'
(R):5'- GATTGATTATAACCTCTCCCCAGG -3'
Posted On 2022-02-07