Incidental Mutation 'R9210:Cfap65'
ID 698755
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock # R9210 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74920408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 861 (T861I)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: T861I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T861I

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,451,331 D40G probably damaging Het
Aass T C 6: 23,075,768 D790G probably damaging Het
Abcb4 C T 5: 8,955,591 P1158L probably damaging Het
Acod1 T C 14: 103,055,090 V350A possibly damaging Het
Acot2 C A 12: 83,988,077 P59Q probably damaging Het
Acyp1 A T 12: 85,280,046 V10E possibly damaging Het
Adhfe1 A T 1: 9,566,811 D396V possibly damaging Het
Agbl3 C T 6: 34,798,242 T161I probably damaging Het
Ang6 T C 14: 44,001,950 N107S probably benign Het
Arhgap28 A G 17: 67,855,435 M639T probably benign Het
Arpc5 A G 1: 152,766,852 D43G probably null Het
Asxl3 T C 18: 22,522,332 I1133T probably benign Het
Atp7b T C 8: 21,997,390 D1303G probably damaging Het
C2cd4b G A 9: 67,759,746 R8H probably damaging Het
Catsper1 T A 19: 5,341,507 V639E probably benign Het
Ccdc113 T C 8: 95,557,246 F316S probably damaging Het
Ccdc91 A G 6: 147,606,900 I375V unknown Het
Chd1 T G 17: 15,730,505 S153A possibly damaging Het
Cln6 A G 9: 62,850,691 H244R probably damaging Het
Cnn2 A T 10: 79,992,539 M117L probably benign Het
Col19a1 A T 1: 24,461,474 probably null Het
Csgalnact1 T C 8: 68,461,589 probably benign Het
Dhx57 T G 17: 80,268,909 D584A probably damaging Het
Dnaaf2 G A 12: 69,197,828 A153V probably damaging Het
Egfem1 T G 3: 29,153,594 C144W probably damaging Het
Ercc6 T A 14: 32,569,865 I1062N probably benign Het
Ermap A T 4: 119,178,509 C427* probably null Het
Fam193a T C 5: 34,440,137 V94A probably benign Het
Fbxl14 T C 6: 119,480,674 M272T probably benign Het
Gm5678 A C 16: 93,630,239 S243R possibly damaging Het
Grm7 T A 6: 110,645,908 M14K probably benign Het
Herc6 A G 6: 57,662,365 Y906C probably damaging Het
Hps4 C A 5: 112,349,361 T70N possibly damaging Het
Hspg2 A G 4: 137,562,479 H3880R probably benign Het
Hus1b A C 13: 30,946,875 I267S possibly damaging Het
Igkv13-84 G T 6: 68,939,902 G61V probably damaging Het
Mrgprb2 A T 7: 48,552,644 V111D possibly damaging Het
Mta3 A T 17: 83,708,417 N16I probably damaging Het
Mtus2 T A 5: 148,077,314 S306T probably benign Het
Ncl G A 1: 86,352,517 P523S probably benign Het
Npepps G T 11: 97,238,221 A379E probably damaging Het
Ntng1 A T 3: 109,872,317 C315S probably damaging Het
Nyap2 C T 1: 81,241,327 P355S probably damaging Het
Olfr474 C A 7: 107,954,810 H56Q probably benign Het
Orc2 A G 1: 58,476,536 L271P probably damaging Het
Pck2 G A 14: 55,542,450 R52H probably benign Het
Pikfyve T C 1: 65,252,560 S1313P probably damaging Het
Pink1 A G 4: 138,325,967 F85L probably benign Het
Ppp2r3a T C 9: 101,185,976 T154A probably benign Het
Prkg2 T C 5: 98,947,474 T613A probably damaging Het
Ptprz1 A G 6: 23,050,494 M2254V probably damaging Het
Rabgap1 T C 2: 37,487,140 V328A probably damaging Het
Rag1 T C 2: 101,644,507 S97G probably benign Het
Rai1 C T 11: 60,189,391 P1427L probably benign Het
Rrp15 G C 1: 186,739,725 A95G probably damaging Het
Rttn T C 18: 89,046,162 probably null Het
Ryr2 A C 13: 11,829,674 I392S probably damaging Het
Scoc T C 8: 83,435,914 K121R possibly damaging Het
Sept5 A T 16: 18,624,211 I206K possibly damaging Het
Sh2d2a C A 3: 87,849,348 L167I probably damaging Het
Slc5a2 C A 7: 128,268,767 Q202K probably damaging Het
Slco4a1 A T 2: 180,472,478 S518C probably damaging Het
Tbc1d2b A T 9: 90,205,130 L932Q possibly damaging Het
Tex15 T A 8: 33,574,291 Y1250N possibly damaging Het
Tln1 G T 4: 43,536,119 T2022K probably damaging Het
Trpc4 T A 3: 54,266,320 F378L probably benign Het
Ush2a A T 1: 188,784,669 Q3192L probably null Het
Usp40 A T 1: 87,957,313 W938R possibly damaging Het
Wdr24 T C 17: 25,824,498 V98A probably benign Het
Zfp280d A G 9: 72,362,507 *975W probably null Het
Zfp317 A T 9: 19,647,146 K219* probably null Het
Zfp986 A G 4: 145,899,228 K153E probably benign Het
Zmiz2 T A 11: 6,396,277 S71T possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74919351 splice site probably benign
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74919342 missense probably benign 0.16
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAATTTCCTGTAAGTTGTGGG -3'
(R):5'- TTCCTCTGGCTCAGGAAGTG -3'

Sequencing Primer
(F):5'- GTAAGGAAGGTTTGACTAAAGCCCAC -3'
(R):5'- GAGGAGCCCCTGGATCTGAAG -3'
Posted On 2022-02-07