Incidental Mutation 'R9210:Cfap65'
ID 698755
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 068983-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R9210 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74959567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 861 (T861I)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: T861I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T861I

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,287,165 (GRCm39) D40G probably damaging Het
Aass T C 6: 23,075,767 (GRCm39) D790G probably damaging Het
Abcb4 C T 5: 9,005,591 (GRCm39) P1158L probably damaging Het
Acod1 T C 14: 103,292,526 (GRCm39) V350A possibly damaging Het
Acot2 C A 12: 84,034,851 (GRCm39) P59Q probably damaging Het
Acyp1 A T 12: 85,326,820 (GRCm39) V10E possibly damaging Het
Adhfe1 A T 1: 9,637,036 (GRCm39) D396V possibly damaging Het
Agbl3 C T 6: 34,775,177 (GRCm39) T161I probably damaging Het
Ang6 T C 14: 44,239,407 (GRCm39) N107S probably benign Het
Arhgap28 A G 17: 68,162,430 (GRCm39) M639T probably benign Het
Arpc5 A G 1: 152,642,603 (GRCm39) D43G probably null Het
Asxl3 T C 18: 22,655,389 (GRCm39) I1133T probably benign Het
Atp7b T C 8: 22,487,406 (GRCm39) D1303G probably damaging Het
C2cd4b G A 9: 67,667,028 (GRCm39) R8H probably damaging Het
Catsper1 T A 19: 5,391,535 (GRCm39) V639E probably benign Het
Cbr1b A C 16: 93,427,127 (GRCm39) S243R possibly damaging Het
Ccdc113 T C 8: 96,283,874 (GRCm39) F316S probably damaging Het
Ccdc91 A G 6: 147,508,398 (GRCm39) I375V unknown Het
Chd1 T G 17: 15,950,767 (GRCm39) S153A possibly damaging Het
Cln6 A G 9: 62,757,973 (GRCm39) H244R probably damaging Het
Cnn2 A T 10: 79,828,373 (GRCm39) M117L probably benign Het
Col19a1 A T 1: 24,500,555 (GRCm39) probably null Het
Csgalnact1 T C 8: 68,914,241 (GRCm39) probably benign Het
Dhx57 T G 17: 80,576,338 (GRCm39) D584A probably damaging Het
Dnaaf2 G A 12: 69,244,602 (GRCm39) A153V probably damaging Het
Egfem1 T G 3: 29,207,743 (GRCm39) C144W probably damaging Het
Ercc6 T A 14: 32,291,822 (GRCm39) I1062N probably benign Het
Ermap A T 4: 119,035,706 (GRCm39) C427* probably null Het
Fam193a T C 5: 34,597,481 (GRCm39) V94A probably benign Het
Fbxl14 T C 6: 119,457,635 (GRCm39) M272T probably benign Het
Grm7 T A 6: 110,622,869 (GRCm39) M14K probably benign Het
Herc6 A G 6: 57,639,350 (GRCm39) Y906C probably damaging Het
Hps4 C A 5: 112,497,227 (GRCm39) T70N possibly damaging Het
Hspg2 A G 4: 137,289,790 (GRCm39) H3880R probably benign Het
Hus1b A C 13: 31,130,858 (GRCm39) I267S possibly damaging Het
Igkv13-84 G T 6: 68,916,886 (GRCm39) G61V probably damaging Het
Mrgprb2 A T 7: 48,202,392 (GRCm39) V111D possibly damaging Het
Mta3 A T 17: 84,015,846 (GRCm39) N16I probably damaging Het
Mtus2 T A 5: 148,014,124 (GRCm39) S306T probably benign Het
Ncl G A 1: 86,280,239 (GRCm39) P523S probably benign Het
Npepps G T 11: 97,129,047 (GRCm39) A379E probably damaging Het
Ntng1 A T 3: 109,779,633 (GRCm39) C315S probably damaging Het
Nyap2 C T 1: 81,219,042 (GRCm39) P355S probably damaging Het
Or5p54 C A 7: 107,554,017 (GRCm39) H56Q probably benign Het
Orc2 A G 1: 58,515,695 (GRCm39) L271P probably damaging Het
Pck2 G A 14: 55,779,907 (GRCm39) R52H probably benign Het
Pikfyve T C 1: 65,291,719 (GRCm39) S1313P probably damaging Het
Pink1 A G 4: 138,053,278 (GRCm39) F85L probably benign Het
Ppp2r3d T C 9: 101,063,175 (GRCm39) T154A probably benign Het
Prkg2 T C 5: 99,095,333 (GRCm39) T613A probably damaging Het
Ptprz1 A G 6: 23,050,493 (GRCm39) M2254V probably damaging Het
Rabgap1 T C 2: 37,377,152 (GRCm39) V328A probably damaging Het
Rag1 T C 2: 101,474,852 (GRCm39) S97G probably benign Het
Rai1 C T 11: 60,080,217 (GRCm39) P1427L probably benign Het
Rrp15 G C 1: 186,471,922 (GRCm39) A95G probably damaging Het
Rttn T C 18: 89,064,286 (GRCm39) probably null Het
Ryr2 A C 13: 11,844,560 (GRCm39) I392S probably damaging Het
Scoc T C 8: 84,162,543 (GRCm39) K121R possibly damaging Het
Septin5 A T 16: 18,442,961 (GRCm39) I206K possibly damaging Het
Sh2d2a C A 3: 87,756,655 (GRCm39) L167I probably damaging Het
Slc5a2 C A 7: 127,867,939 (GRCm39) Q202K probably damaging Het
Slco4a1 A T 2: 180,114,271 (GRCm39) S518C probably damaging Het
Tbc1d2b A T 9: 90,087,183 (GRCm39) L932Q possibly damaging Het
Tex15 T A 8: 34,064,319 (GRCm39) Y1250N possibly damaging Het
Tln1 G T 4: 43,536,119 (GRCm39) T2022K probably damaging Het
Trpc4 T A 3: 54,173,741 (GRCm39) F378L probably benign Het
Ush2a A T 1: 188,516,866 (GRCm39) Q3192L probably null Het
Usp40 A T 1: 87,885,035 (GRCm39) W938R possibly damaging Het
Wdr24 T C 17: 26,043,472 (GRCm39) V98A probably benign Het
Zfp280d A G 9: 72,269,789 (GRCm39) *975W probably null Het
Zfp317 A T 9: 19,558,442 (GRCm39) K219* probably null Het
Zfp986 A G 4: 145,625,798 (GRCm39) K153E probably benign Het
Zmiz2 T A 11: 6,346,277 (GRCm39) S71T possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAATTTCCTGTAAGTTGTGGG -3'
(R):5'- TTCCTCTGGCTCAGGAAGTG -3'

Sequencing Primer
(F):5'- GTAAGGAAGGTTTGACTAAAGCCCAC -3'
(R):5'- GAGGAGCCCCTGGATCTGAAG -3'
Posted On 2022-02-07