Incidental Mutation 'R9210:Slco4a1'
ID 698764
Institutional Source Beutler Lab
Gene Symbol Slco4a1
Ensembl Gene ENSMUSG00000038963
Gene Name solute carrier organic anion transporter family, member 4a1
Synonyms Slc21a12, OATP-E
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock # R9210 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 180456245-180474867 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 180472478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 518 (S518C)
Ref Sequence ENSEMBL: ENSMUSP00000045023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038225] [ENSMUST00000038259]
AlphaFold Q8K078
Predicted Effect probably damaging
Transcript: ENSMUST00000038225
AA Change: S518C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045023
Gene: ENSMUSG00000038963
AA Change: S518C

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 103 665 5.7e-168 PFAM
Pfam:MFS_1 105 496 3e-15 PFAM
Pfam:Kazal_2 512 555 1.1e-7 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038259
AA Change: S518C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046502
Gene: ENSMUSG00000038963
AA Change: S518C

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 101 666 2.8e-172 PFAM
Pfam:MFS_1 105 496 2.5e-15 PFAM
Pfam:Kazal_2 512 555 7.7e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,451,331 D40G probably damaging Het
Aass T C 6: 23,075,768 D790G probably damaging Het
Abcb4 C T 5: 8,955,591 P1158L probably damaging Het
Acod1 T C 14: 103,055,090 V350A possibly damaging Het
Acot2 C A 12: 83,988,077 P59Q probably damaging Het
Acyp1 A T 12: 85,280,046 V10E possibly damaging Het
Adhfe1 A T 1: 9,566,811 D396V possibly damaging Het
Agbl3 C T 6: 34,798,242 T161I probably damaging Het
Ang6 T C 14: 44,001,950 N107S probably benign Het
Arhgap28 A G 17: 67,855,435 M639T probably benign Het
Arpc5 A G 1: 152,766,852 D43G probably null Het
Asxl3 T C 18: 22,522,332 I1133T probably benign Het
Atp7b T C 8: 21,997,390 D1303G probably damaging Het
C2cd4b G A 9: 67,759,746 R8H probably damaging Het
Catsper1 T A 19: 5,341,507 V639E probably benign Het
Ccdc113 T C 8: 95,557,246 F316S probably damaging Het
Ccdc91 A G 6: 147,606,900 I375V unknown Het
Cfap65 G A 1: 74,920,408 T861I probably benign Het
Chd1 T G 17: 15,730,505 S153A possibly damaging Het
Cln6 A G 9: 62,850,691 H244R probably damaging Het
Cnn2 A T 10: 79,992,539 M117L probably benign Het
Col19a1 A T 1: 24,461,474 probably null Het
Csgalnact1 T C 8: 68,461,589 probably benign Het
Dhx57 T G 17: 80,268,909 D584A probably damaging Het
Dnaaf2 G A 12: 69,197,828 A153V probably damaging Het
Egfem1 T G 3: 29,153,594 C144W probably damaging Het
Ercc6 T A 14: 32,569,865 I1062N probably benign Het
Ermap A T 4: 119,178,509 C427* probably null Het
Fam193a T C 5: 34,440,137 V94A probably benign Het
Fbxl14 T C 6: 119,480,674 M272T probably benign Het
Gm5678 A C 16: 93,630,239 S243R possibly damaging Het
Grm7 T A 6: 110,645,908 M14K probably benign Het
Herc6 A G 6: 57,662,365 Y906C probably damaging Het
Hps4 C A 5: 112,349,361 T70N possibly damaging Het
Hspg2 A G 4: 137,562,479 H3880R probably benign Het
Hus1b A C 13: 30,946,875 I267S possibly damaging Het
Igkv13-84 G T 6: 68,939,902 G61V probably damaging Het
Mrgprb2 A T 7: 48,552,644 V111D possibly damaging Het
Mta3 A T 17: 83,708,417 N16I probably damaging Het
Mtus2 T A 5: 148,077,314 S306T probably benign Het
Ncl G A 1: 86,352,517 P523S probably benign Het
Npepps G T 11: 97,238,221 A379E probably damaging Het
Ntng1 A T 3: 109,872,317 C315S probably damaging Het
Nyap2 C T 1: 81,241,327 P355S probably damaging Het
Olfr474 C A 7: 107,954,810 H56Q probably benign Het
Orc2 A G 1: 58,476,536 L271P probably damaging Het
Pck2 G A 14: 55,542,450 R52H probably benign Het
Pikfyve T C 1: 65,252,560 S1313P probably damaging Het
Pink1 A G 4: 138,325,967 F85L probably benign Het
Ppp2r3a T C 9: 101,185,976 T154A probably benign Het
Prb1 TAGGCCTCCCTGTGGGTGTGGGCCTTGTTGGTTTCCAGGCTGAGGAGGTCTCTGCTGGGGGCCTCCCTGTGGGGGTGGACCTTGTTGGTTTCCAGGCTGAGG TGGGCCTCCCTGTGGGGGTGGACCTTGTTGGTTTCCAGGCTGAGG 6: 132,207,904 probably benign Het
Prkg2 T C 5: 98,947,474 T613A probably damaging Het
Ptprz1 A G 6: 23,050,494 M2254V probably damaging Het
Rabgap1 T C 2: 37,487,140 V328A probably damaging Het
Rag1 T C 2: 101,644,507 S97G probably benign Het
Rai1 C T 11: 60,189,391 P1427L probably benign Het
Rrp15 G C 1: 186,739,725 A95G probably damaging Het
Rttn T C 18: 89,046,162 probably null Het
Ryr2 A C 13: 11,829,674 I392S probably damaging Het
Scoc T C 8: 83,435,914 K121R possibly damaging Het
Sept5 A T 16: 18,624,211 I206K possibly damaging Het
Sh2d2a C A 3: 87,849,348 L167I probably damaging Het
Slc5a2 C A 7: 128,268,767 Q202K probably damaging Het
Tbc1d2b A T 9: 90,205,130 L932Q possibly damaging Het
Tex15 T A 8: 33,574,291 Y1250N possibly damaging Het
Tln1 G T 4: 43,536,119 T2022K probably damaging Het
Trpc4 T A 3: 54,266,320 F378L probably benign Het
Ush2a A T 1: 188,784,669 Q3192L probably null Het
Usp40 A T 1: 87,957,313 W938R possibly damaging Het
Wdr24 T C 17: 25,824,498 V98A probably benign Het
Zfp280d A G 9: 72,362,507 *975W probably null Het
Zfp317 A T 9: 19,647,146 K219* probably null Het
Zfp986 A G 4: 145,899,228 K153E probably benign Het
Zmiz2 T A 11: 6,396,277 S71T possibly damaging Het
Other mutations in Slco4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Slco4a1 APN 2 180464679 missense probably damaging 1.00
IGL01982:Slco4a1 APN 2 180473153 missense probably benign 0.03
IGL02297:Slco4a1 APN 2 180464489 missense probably benign 0.16
IGL02368:Slco4a1 APN 2 180473128 missense probably damaging 0.98
conduit UTSW 2 180473615 missense probably damaging 1.00
ingress UTSW 2 180465677 missense probably benign
R1621:Slco4a1 UTSW 2 180471132 missense probably benign 0.01
R2275:Slco4a1 UTSW 2 180464736 missense possibly damaging 0.94
R2472:Slco4a1 UTSW 2 180467087 missense probably damaging 1.00
R3851:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R3852:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R4271:Slco4a1 UTSW 2 180474210 missense possibly damaging 0.85
R4439:Slco4a1 UTSW 2 180472662 missense probably benign 0.02
R4571:Slco4a1 UTSW 2 180464378 missense probably benign 0.32
R4732:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4733:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4925:Slco4a1 UTSW 2 180472056 missense probably benign 0.35
R5156:Slco4a1 UTSW 2 180472779 missense probably benign 0.01
R5186:Slco4a1 UTSW 2 180473108 missense probably damaging 1.00
R5252:Slco4a1 UTSW 2 180464459 missense possibly damaging 0.48
R5426:Slco4a1 UTSW 2 180471235 missense possibly damaging 0.84
R5470:Slco4a1 UTSW 2 180474114 missense probably benign 0.00
R5512:Slco4a1 UTSW 2 180474114 missense possibly damaging 0.91
R6969:Slco4a1 UTSW 2 180464808 missense probably benign
R7133:Slco4a1 UTSW 2 180472063 missense possibly damaging 0.93
R7249:Slco4a1 UTSW 2 180464811 missense probably benign 0.01
R7357:Slco4a1 UTSW 2 180472137 missense probably benign 0.00
R7442:Slco4a1 UTSW 2 180474126 missense probably benign
R7599:Slco4a1 UTSW 2 180471255 missense probably benign
R7750:Slco4a1 UTSW 2 180471237 missense probably benign 0.30
R7834:Slco4a1 UTSW 2 180465677 missense probably benign
R8203:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R8504:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R9166:Slco4a1 UTSW 2 180464241 missense probably benign 0.00
R9170:Slco4a1 UTSW 2 180464685 missense probably benign 0.00
R9455:Slco4a1 UTSW 2 180473577 missense probably benign 0.05
Z1177:Slco4a1 UTSW 2 180464381 missense possibly damaging 0.85
Z1177:Slco4a1 UTSW 2 180464564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGAGCCTAGTAGAGACCCTAC -3'
(R):5'- TACAGCCTCGGTATACCTGG -3'

Sequencing Primer
(F):5'- TAGAGACCCTACACGTGGG -3'
(R):5'- TCGGTATACCTGGGGAGC -3'
Posted On 2022-02-07