Incidental Mutation 'R9210:Hspg2'
ID 698771
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Name perlecan (heparan sulfate proteoglycan 2)
Synonyms Plc, per, perlecan, Pcn
MMRRC Submission 068983-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9210 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137196080-137297941 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137289790 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 3880 (H3880R)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000030547
AA Change: H3872R

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: H3872R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171332
AA Change: H3880R

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: H3880R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,287,165 (GRCm39) D40G probably damaging Het
Aass T C 6: 23,075,767 (GRCm39) D790G probably damaging Het
Abcb4 C T 5: 9,005,591 (GRCm39) P1158L probably damaging Het
Acod1 T C 14: 103,292,526 (GRCm39) V350A possibly damaging Het
Acot2 C A 12: 84,034,851 (GRCm39) P59Q probably damaging Het
Acyp1 A T 12: 85,326,820 (GRCm39) V10E possibly damaging Het
Adhfe1 A T 1: 9,637,036 (GRCm39) D396V possibly damaging Het
Agbl3 C T 6: 34,775,177 (GRCm39) T161I probably damaging Het
Ang6 T C 14: 44,239,407 (GRCm39) N107S probably benign Het
Arhgap28 A G 17: 68,162,430 (GRCm39) M639T probably benign Het
Arpc5 A G 1: 152,642,603 (GRCm39) D43G probably null Het
Asxl3 T C 18: 22,655,389 (GRCm39) I1133T probably benign Het
Atp7b T C 8: 22,487,406 (GRCm39) D1303G probably damaging Het
C2cd4b G A 9: 67,667,028 (GRCm39) R8H probably damaging Het
Catsper1 T A 19: 5,391,535 (GRCm39) V639E probably benign Het
Cbr1b A C 16: 93,427,127 (GRCm39) S243R possibly damaging Het
Ccdc113 T C 8: 96,283,874 (GRCm39) F316S probably damaging Het
Ccdc91 A G 6: 147,508,398 (GRCm39) I375V unknown Het
Cfap65 G A 1: 74,959,567 (GRCm39) T861I probably benign Het
Chd1 T G 17: 15,950,767 (GRCm39) S153A possibly damaging Het
Cln6 A G 9: 62,757,973 (GRCm39) H244R probably damaging Het
Cnn2 A T 10: 79,828,373 (GRCm39) M117L probably benign Het
Col19a1 A T 1: 24,500,555 (GRCm39) probably null Het
Csgalnact1 T C 8: 68,914,241 (GRCm39) probably benign Het
Dhx57 T G 17: 80,576,338 (GRCm39) D584A probably damaging Het
Dnaaf2 G A 12: 69,244,602 (GRCm39) A153V probably damaging Het
Egfem1 T G 3: 29,207,743 (GRCm39) C144W probably damaging Het
Ercc6 T A 14: 32,291,822 (GRCm39) I1062N probably benign Het
Ermap A T 4: 119,035,706 (GRCm39) C427* probably null Het
Fam193a T C 5: 34,597,481 (GRCm39) V94A probably benign Het
Fbxl14 T C 6: 119,457,635 (GRCm39) M272T probably benign Het
Grm7 T A 6: 110,622,869 (GRCm39) M14K probably benign Het
Herc6 A G 6: 57,639,350 (GRCm39) Y906C probably damaging Het
Hps4 C A 5: 112,497,227 (GRCm39) T70N possibly damaging Het
Hus1b A C 13: 31,130,858 (GRCm39) I267S possibly damaging Het
Igkv13-84 G T 6: 68,916,886 (GRCm39) G61V probably damaging Het
Mrgprb2 A T 7: 48,202,392 (GRCm39) V111D possibly damaging Het
Mta3 A T 17: 84,015,846 (GRCm39) N16I probably damaging Het
Mtus2 T A 5: 148,014,124 (GRCm39) S306T probably benign Het
Ncl G A 1: 86,280,239 (GRCm39) P523S probably benign Het
Npepps G T 11: 97,129,047 (GRCm39) A379E probably damaging Het
Ntng1 A T 3: 109,779,633 (GRCm39) C315S probably damaging Het
Nyap2 C T 1: 81,219,042 (GRCm39) P355S probably damaging Het
Or5p54 C A 7: 107,554,017 (GRCm39) H56Q probably benign Het
Orc2 A G 1: 58,515,695 (GRCm39) L271P probably damaging Het
Pck2 G A 14: 55,779,907 (GRCm39) R52H probably benign Het
Pikfyve T C 1: 65,291,719 (GRCm39) S1313P probably damaging Het
Pink1 A G 4: 138,053,278 (GRCm39) F85L probably benign Het
Ppp2r3d T C 9: 101,063,175 (GRCm39) T154A probably benign Het
Prkg2 T C 5: 99,095,333 (GRCm39) T613A probably damaging Het
Ptprz1 A G 6: 23,050,493 (GRCm39) M2254V probably damaging Het
Rabgap1 T C 2: 37,377,152 (GRCm39) V328A probably damaging Het
Rag1 T C 2: 101,474,852 (GRCm39) S97G probably benign Het
Rai1 C T 11: 60,080,217 (GRCm39) P1427L probably benign Het
Rrp15 G C 1: 186,471,922 (GRCm39) A95G probably damaging Het
Rttn T C 18: 89,064,286 (GRCm39) probably null Het
Ryr2 A C 13: 11,844,560 (GRCm39) I392S probably damaging Het
Scoc T C 8: 84,162,543 (GRCm39) K121R possibly damaging Het
Septin5 A T 16: 18,442,961 (GRCm39) I206K possibly damaging Het
Sh2d2a C A 3: 87,756,655 (GRCm39) L167I probably damaging Het
Slc5a2 C A 7: 127,867,939 (GRCm39) Q202K probably damaging Het
Slco4a1 A T 2: 180,114,271 (GRCm39) S518C probably damaging Het
Tbc1d2b A T 9: 90,087,183 (GRCm39) L932Q possibly damaging Het
Tex15 T A 8: 34,064,319 (GRCm39) Y1250N possibly damaging Het
Tln1 G T 4: 43,536,119 (GRCm39) T2022K probably damaging Het
Trpc4 T A 3: 54,173,741 (GRCm39) F378L probably benign Het
Ush2a A T 1: 188,516,866 (GRCm39) Q3192L probably null Het
Usp40 A T 1: 87,885,035 (GRCm39) W938R possibly damaging Het
Wdr24 T C 17: 26,043,472 (GRCm39) V98A probably benign Het
Zfp280d A G 9: 72,269,789 (GRCm39) *975W probably null Het
Zfp317 A T 9: 19,558,442 (GRCm39) K219* probably null Het
Zfp986 A G 4: 145,625,798 (GRCm39) K153E probably benign Het
Zmiz2 T A 11: 6,346,277 (GRCm39) S71T possibly damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137,256,131 (GRCm39) missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137,266,506 (GRCm39) missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137,289,512 (GRCm39) missense probably benign 0.15
IGL00970:Hspg2 APN 4 137,269,901 (GRCm39) missense probably benign 0.09
IGL01011:Hspg2 APN 4 137,286,646 (GRCm39) missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137,273,969 (GRCm39) missense probably benign 0.11
IGL01333:Hspg2 APN 4 137,267,625 (GRCm39) missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137,265,800 (GRCm39) missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137,281,128 (GRCm39) missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137,247,017 (GRCm39) missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137,266,494 (GRCm39) missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137,280,114 (GRCm39) missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137,242,084 (GRCm39) missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137,292,237 (GRCm39) missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137,239,982 (GRCm39) missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137,289,237 (GRCm39) missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137,267,384 (GRCm39) missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137,279,565 (GRCm39) missense probably benign
IGL02051:Hspg2 APN 4 137,295,700 (GRCm39) unclassified probably benign
IGL02124:Hspg2 APN 4 137,246,125 (GRCm39) splice site probably null
IGL02128:Hspg2 APN 4 137,291,327 (GRCm39) missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137,242,627 (GRCm39) missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137,245,956 (GRCm39) missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137,237,888 (GRCm39) missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137,235,700 (GRCm39) missense probably benign 0.03
IGL02477:Hspg2 APN 4 137,271,823 (GRCm39) splice site probably benign
IGL02514:Hspg2 APN 4 137,296,887 (GRCm39) missense probably benign 0.09
IGL02613:Hspg2 APN 4 137,271,731 (GRCm39) missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137,239,953 (GRCm39) missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137,279,159 (GRCm39) missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137,284,756 (GRCm39) splice site probably benign
IGL02701:Hspg2 APN 4 137,284,485 (GRCm39) missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137,282,441 (GRCm39) missense probably benign 0.00
IGL02985:Hspg2 APN 4 137,235,114 (GRCm39) missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137,289,136 (GRCm39) critical splice donor site probably null
IGL03181:Hspg2 APN 4 137,243,248 (GRCm39) missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137,287,833 (GRCm39) splice site probably benign
G1patch:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
PIT4305001:Hspg2 UTSW 4 137,277,684 (GRCm39) missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137,247,242 (GRCm39) missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137,270,160 (GRCm39) missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137,289,512 (GRCm39) missense probably benign 0.15
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137,238,469 (GRCm39) missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137,242,734 (GRCm39) missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137,260,840 (GRCm39) missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137,277,335 (GRCm39) missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137,229,605 (GRCm39) missense probably benign
R0599:Hspg2 UTSW 4 137,239,712 (GRCm39) missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137,280,591 (GRCm39) missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137,239,660 (GRCm39) missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137,268,751 (GRCm39) missense probably benign 0.00
R1403:Hspg2 UTSW 4 137,267,411 (GRCm39) missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137,244,947 (GRCm39) missense probably benign
R1497:Hspg2 UTSW 4 137,275,407 (GRCm39) missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137,238,552 (GRCm39) splice site probably benign
R1625:Hspg2 UTSW 4 137,246,282 (GRCm39) missense probably benign 0.23
R1630:Hspg2 UTSW 4 137,245,746 (GRCm39) missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137,260,748 (GRCm39) nonsense probably null
R1699:Hspg2 UTSW 4 137,275,323 (GRCm39) splice site probably null
R1703:Hspg2 UTSW 4 137,286,462 (GRCm39) missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137,241,984 (GRCm39) missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137,247,467 (GRCm39) missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137,245,820 (GRCm39) missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137,272,878 (GRCm39) missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137,292,801 (GRCm39) missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137,269,863 (GRCm39) missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137,292,206 (GRCm39) missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137,295,677 (GRCm39) missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137,286,678 (GRCm39) missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137,247,420 (GRCm39) missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137,244,915 (GRCm39) missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137,249,354 (GRCm39) missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137,276,885 (GRCm39) missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137,282,601 (GRCm39) missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137,292,815 (GRCm39) splice site probably benign
R3873:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137,286,625 (GRCm39) missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137,283,968 (GRCm39) missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137,196,222 (GRCm39) missense probably benign 0.17
R4355:Hspg2 UTSW 4 137,256,729 (GRCm39) missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4411:Hspg2 UTSW 4 137,289,535 (GRCm39) missense probably benign
R4421:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4592:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137,266,886 (GRCm39) missense possibly damaging 0.80
R4612:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4619:Hspg2 UTSW 4 137,273,884 (GRCm39) missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137,261,041 (GRCm39) missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137,266,956 (GRCm39) missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137,249,438 (GRCm39) missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137,297,384 (GRCm39) unclassified probably benign
R4793:Hspg2 UTSW 4 137,256,784 (GRCm39) missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137,292,706 (GRCm39) missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137,268,977 (GRCm39) missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137,269,841 (GRCm39) missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137,235,342 (GRCm39) missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137,239,237 (GRCm39) missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137,271,225 (GRCm39) missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137,256,105 (GRCm39) splice site probably null
R5529:Hspg2 UTSW 4 137,279,139 (GRCm39) missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137,270,136 (GRCm39) missense probably benign 0.17
R5541:Hspg2 UTSW 4 137,247,862 (GRCm39) missense probably damaging 1.00
R5546:Hspg2 UTSW 4 137,275,485 (GRCm39) critical splice donor site probably null
R5728:Hspg2 UTSW 4 137,270,077 (GRCm39) missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137,289,032 (GRCm39) missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137,281,093 (GRCm39) missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137,268,046 (GRCm39) missense probably benign
R6164:Hspg2 UTSW 4 137,241,966 (GRCm39) missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137,296,829 (GRCm39) missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137,267,559 (GRCm39) missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137,246,997 (GRCm39) missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137,272,016 (GRCm39) missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137,289,266 (GRCm39) missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137,269,006 (GRCm39) missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137,266,707 (GRCm39) missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137,235,112 (GRCm39) missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137,282,586 (GRCm39) missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137,293,048 (GRCm39) missense probably benign 0.18
R6724:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137,279,114 (GRCm39) missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137,235,709 (GRCm39) missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137,268,031 (GRCm39) missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137,246,600 (GRCm39) missense probably benign 0.45
R6968:Hspg2 UTSW 4 137,262,467 (GRCm39) missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137,256,201 (GRCm39) missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137,269,580 (GRCm39) missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137,271,677 (GRCm39) missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137,237,963 (GRCm39) missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137,279,427 (GRCm39) missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137,242,030 (GRCm39) missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137,260,872 (GRCm39) critical splice donor site probably null
R7238:Hspg2 UTSW 4 137,235,704 (GRCm39) missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137,247,257 (GRCm39) missense probably benign 0.15
R7278:Hspg2 UTSW 4 137,278,436 (GRCm39) missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137,256,867 (GRCm39) missense probably benign 0.00
R7390:Hspg2 UTSW 4 137,266,490 (GRCm39) missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137,242,975 (GRCm39) missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137,266,714 (GRCm39) missense probably benign 0.17
R7516:Hspg2 UTSW 4 137,269,931 (GRCm39) missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137,268,751 (GRCm39) missense possibly damaging 0.51
R7603:Hspg2 UTSW 4 137,284,503 (GRCm39) missense possibly damaging 0.91
R7603:Hspg2 UTSW 4 137,275,679 (GRCm39) missense probably damaging 1.00
R7625:Hspg2 UTSW 4 137,292,249 (GRCm39) missense probably damaging 1.00
R7696:Hspg2 UTSW 4 137,239,277 (GRCm39) missense possibly damaging 0.78
R7767:Hspg2 UTSW 4 137,239,177 (GRCm39) missense probably damaging 1.00
R7815:Hspg2 UTSW 4 137,239,775 (GRCm39) missense probably damaging 1.00
R7825:Hspg2 UTSW 4 137,286,160 (GRCm39) missense probably damaging 1.00
R7863:Hspg2 UTSW 4 137,292,135 (GRCm39) missense probably benign 0.03
R7885:Hspg2 UTSW 4 137,244,148 (GRCm39) missense probably damaging 1.00
R7899:Hspg2 UTSW 4 137,275,427 (GRCm39) missense possibly damaging 0.72
R7937:Hspg2 UTSW 4 137,278,243 (GRCm39) missense probably benign 0.01
R7975:Hspg2 UTSW 4 137,282,532 (GRCm39) missense probably benign 0.26
R8078:Hspg2 UTSW 4 137,235,333 (GRCm39) missense probably damaging 1.00
R8285:Hspg2 UTSW 4 137,239,974 (GRCm39) missense probably benign 0.18
R8314:Hspg2 UTSW 4 137,266,986 (GRCm39) missense probably benign 0.12
R8322:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8323:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8324:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8341:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8383:Hspg2 UTSW 4 137,271,681 (GRCm39) missense possibly damaging 0.66
R8425:Hspg2 UTSW 4 137,278,178 (GRCm39) nonsense probably null
R8491:Hspg2 UTSW 4 137,281,030 (GRCm39) missense probably benign 0.00
R8525:Hspg2 UTSW 4 137,266,759 (GRCm39) missense probably damaging 0.98
R8978:Hspg2 UTSW 4 137,291,341 (GRCm39) missense probably benign 0.09
R9152:Hspg2 UTSW 4 137,249,876 (GRCm39) missense possibly damaging 0.89
R9166:Hspg2 UTSW 4 137,270,185 (GRCm39) missense probably damaging 1.00
R9175:Hspg2 UTSW 4 137,256,657 (GRCm39) missense probably damaging 0.98
R9221:Hspg2 UTSW 4 137,287,726 (GRCm39) missense possibly damaging 0.79
R9325:Hspg2 UTSW 4 137,265,552 (GRCm39) missense probably damaging 1.00
R9339:Hspg2 UTSW 4 137,278,480 (GRCm39) missense probably benign
R9340:Hspg2 UTSW 4 137,296,827 (GRCm39) missense probably damaging 1.00
R9358:Hspg2 UTSW 4 137,244,909 (GRCm39) missense probably damaging 1.00
R9451:Hspg2 UTSW 4 137,238,380 (GRCm39) missense probably damaging 1.00
R9534:Hspg2 UTSW 4 137,268,072 (GRCm39) missense probably benign
R9656:Hspg2 UTSW 4 137,279,196 (GRCm39) missense probably benign
R9664:Hspg2 UTSW 4 137,266,887 (GRCm39) missense probably benign 0.03
R9695:Hspg2 UTSW 4 137,265,701 (GRCm39) missense probably damaging 1.00
R9741:Hspg2 UTSW 4 137,239,962 (GRCm39) missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137,277,702 (GRCm39) missense probably benign
Z1177:Hspg2 UTSW 4 137,295,684 (GRCm39) missense possibly damaging 0.64
Z1177:Hspg2 UTSW 4 137,291,829 (GRCm39) missense probably damaging 0.99
Z1177:Hspg2 UTSW 4 137,277,778 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCATGACGTCAACCTCAC -3'
(R):5'- GAACGCAGGGTATGAATGCC -3'

Sequencing Primer
(F):5'- ACTGCCCTACTTGCCAGGAC -3'
(R):5'- CAGGGTATGAATGCCTGACTC -3'
Posted On 2022-02-07