Mutagenetix > Incidental Mutation

Incidental Mutation 'R9210:Agbl3'

698781

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

068983-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9210 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34798242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 161 (T161I)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: T161I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: T161I

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: T156I

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: T156I

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135304
AA Change: T156I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836
AA Change: T156I

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148834
AA Change: T156I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836
AA Change: T156I

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (74/74)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	G	10: 76,451,331	D40G	probably damaging	Het
Aass	T	C	6: 23,075,768	D790G	probably damaging	Het
Abcb4	C	T	5: 8,955,591	P1158L	probably damaging	Het
Acod1	T	C	14: 103,055,090	V350A	possibly damaging	Het
Acot2	C	A	12: 83,988,077	P59Q	probably damaging	Het
Acyp1	A	T	12: 85,280,046	V10E	possibly damaging	Het
Adhfe1	A	T	1: 9,566,811	D396V	possibly damaging	Het
Ang6	T	C	14: 44,001,950	N107S	probably benign	Het
Arhgap28	A	G	17: 67,855,435	M639T	probably benign	Het
Arpc5	A	G	1: 152,766,852	D43G	probably null	Het
Asxl3	T	C	18: 22,522,332	I1133T	probably benign	Het
Atp7b	T	C	8: 21,997,390	D1303G	probably damaging	Het
C2cd4b	G	A	9: 67,759,746	R8H	probably damaging	Het
Catsper1	T	A	19: 5,341,507	V639E	probably benign	Het
Ccdc113	T	C	8: 95,557,246	F316S	probably damaging	Het
Ccdc91	A	G	6: 147,606,900	I375V	unknown	Het
Cfap65	G	A	1: 74,920,408	T861I	probably benign	Het
Chd1	T	G	17: 15,730,505	S153A	possibly damaging	Het
Cln6	A	G	9: 62,850,691	H244R	probably damaging	Het
Cnn2	A	T	10: 79,992,539	M117L	probably benign	Het
Col19a1	A	T	1: 24,461,474		probably null	Het
Csgalnact1	T	C	8: 68,461,589		probably benign	Het
Dhx57	T	G	17: 80,268,909	D584A	probably damaging	Het
Dnaaf2	G	A	12: 69,197,828	A153V	probably damaging	Het
Egfem1	T	G	3: 29,153,594	C144W	probably damaging	Het
Ercc6	T	A	14: 32,569,865	I1062N	probably benign	Het
Ermap	A	T	4: 119,178,509	C427*	probably null	Het
Fam193a	T	C	5: 34,440,137	V94A	probably benign	Het
Fbxl14	T	C	6: 119,480,674	M272T	probably benign	Het
Gm5678	A	C	16: 93,630,239	S243R	possibly damaging	Het
Grm7	T	A	6: 110,645,908	M14K	probably benign	Het
Herc6	A	G	6: 57,662,365	Y906C	probably damaging	Het
Hps4	C	A	5: 112,349,361	T70N	possibly damaging	Het
Hspg2	A	G	4: 137,562,479	H3880R	probably benign	Het
Hus1b	A	C	13: 30,946,875	I267S	possibly damaging	Het
Igkv13-84	G	T	6: 68,939,902	G61V	probably damaging	Het
Mrgprb2	A	T	7: 48,552,644	V111D	possibly damaging	Het
Mta3	A	T	17: 83,708,417	N16I	probably damaging	Het
Mtus2	T	A	5: 148,077,314	S306T	probably benign	Het
Ncl	G	A	1: 86,352,517	P523S	probably benign	Het
Npepps	G	T	11: 97,238,221	A379E	probably damaging	Het
Ntng1	A	T	3: 109,872,317	C315S	probably damaging	Het
Nyap2	C	T	1: 81,241,327	P355S	probably damaging	Het
Olfr474	C	A	7: 107,954,810	H56Q	probably benign	Het
Orc2	A	G	1: 58,476,536	L271P	probably damaging	Het
Pck2	G	A	14: 55,542,450	R52H	probably benign	Het
Pikfyve	T	C	1: 65,252,560	S1313P	probably damaging	Het
Pink1	A	G	4: 138,325,967	F85L	probably benign	Het
Ppp2r3a	T	C	9: 101,185,976	T154A	probably benign	Het
Prkg2	T	C	5: 98,947,474	T613A	probably damaging	Het
Ptprz1	A	G	6: 23,050,494	M2254V	probably damaging	Het
Rabgap1	T	C	2: 37,487,140	V328A	probably damaging	Het
Rag1	T	C	2: 101,644,507	S97G	probably benign	Het
Rai1	C	T	11: 60,189,391	P1427L	probably benign	Het
Rrp15	G	C	1: 186,739,725	A95G	probably damaging	Het
Rttn	T	C	18: 89,046,162		probably null	Het
Ryr2	A	C	13: 11,829,674	I392S	probably damaging	Het
Scoc	T	C	8: 83,435,914	K121R	possibly damaging	Het
Sept5	A	T	16: 18,624,211	I206K	possibly damaging	Het
Sh2d2a	C	A	3: 87,849,348	L167I	probably damaging	Het
Slc5a2	C	A	7: 128,268,767	Q202K	probably damaging	Het
Slco4a1	A	T	2: 180,472,478	S518C	probably damaging	Het
Tbc1d2b	A	T	9: 90,205,130	L932Q	possibly damaging	Het
Tex15	T	A	8: 33,574,291	Y1250N	possibly damaging	Het
Tln1	G	T	4: 43,536,119	T2022K	probably damaging	Het
Trpc4	T	A	3: 54,266,320	F378L	probably benign	Het
Ush2a	A	T	1: 188,784,669	Q3192L	probably null	Het
Usp40	A	T	1: 87,957,313	W938R	possibly damaging	Het
Wdr24	T	C	17: 25,824,498	V98A	probably benign	Het
Zfp280d	A	G	9: 72,362,507	*975W	probably null	Het
Zfp317	A	T	9: 19,647,146	K219*	probably null	Het
Zfp986	A	G	4: 145,899,228	K153E	probably benign	Het
Zmiz2	T	A	11: 6,396,277	S71T	possibly damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTGTGTCCTAAGCAGAATCCAG -3'
(R):5'- GAGTTATAAATACTGGCCTAGGAATGG -3'

Sequencing Primer
(F):5'- GCAGAATCCAGAACTTAGTCTCTG -3'
(R):5'- TAGCGAACGACCTACTTC -3'

Posted On

2022-02-07