Incidental Mutation 'R9210:Agbl3'
ID 698781
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene Name ATP/GTP binding protein-like 3
Synonyms 4930431N21Rik, 2900053G10Rik, 6530406M24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9210 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34780432-34859459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34798242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 161 (T161I)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]
AlphaFold Q8CDP0
Predicted Effect probably damaging
Transcript: ENSMUST00000115016
AA Change: T161I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: T161I

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115017
AA Change: T156I

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: T156I

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135304
AA Change: T156I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836
AA Change: T156I

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148834
AA Change: T156I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836
AA Change: T156I

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,451,331 D40G probably damaging Het
Aass T C 6: 23,075,768 D790G probably damaging Het
Abcb4 C T 5: 8,955,591 P1158L probably damaging Het
Acod1 T C 14: 103,055,090 V350A possibly damaging Het
Acot2 C A 12: 83,988,077 P59Q probably damaging Het
Acyp1 A T 12: 85,280,046 V10E possibly damaging Het
Adhfe1 A T 1: 9,566,811 D396V possibly damaging Het
Ang6 T C 14: 44,001,950 N107S probably benign Het
Arhgap28 A G 17: 67,855,435 M639T probably benign Het
Arpc5 A G 1: 152,766,852 D43G probably null Het
Asxl3 T C 18: 22,522,332 I1133T probably benign Het
Atp7b T C 8: 21,997,390 D1303G probably damaging Het
C2cd4b G A 9: 67,759,746 R8H probably damaging Het
Catsper1 T A 19: 5,341,507 V639E probably benign Het
Ccdc113 T C 8: 95,557,246 F316S probably damaging Het
Ccdc91 A G 6: 147,606,900 I375V unknown Het
Cfap65 G A 1: 74,920,408 T861I probably benign Het
Chd1 T G 17: 15,730,505 S153A possibly damaging Het
Cln6 A G 9: 62,850,691 H244R probably damaging Het
Cnn2 A T 10: 79,992,539 M117L probably benign Het
Col19a1 A T 1: 24,461,474 probably null Het
Csgalnact1 T C 8: 68,461,589 probably benign Het
Dhx57 T G 17: 80,268,909 D584A probably damaging Het
Dnaaf2 G A 12: 69,197,828 A153V probably damaging Het
Egfem1 T G 3: 29,153,594 C144W probably damaging Het
Ercc6 T A 14: 32,569,865 I1062N probably benign Het
Ermap A T 4: 119,178,509 C427* probably null Het
Fam193a T C 5: 34,440,137 V94A probably benign Het
Fbxl14 T C 6: 119,480,674 M272T probably benign Het
Gm5678 A C 16: 93,630,239 S243R possibly damaging Het
Grm7 T A 6: 110,645,908 M14K probably benign Het
Herc6 A G 6: 57,662,365 Y906C probably damaging Het
Hps4 C A 5: 112,349,361 T70N possibly damaging Het
Hspg2 A G 4: 137,562,479 H3880R probably benign Het
Hus1b A C 13: 30,946,875 I267S possibly damaging Het
Igkv13-84 G T 6: 68,939,902 G61V probably damaging Het
Mrgprb2 A T 7: 48,552,644 V111D possibly damaging Het
Mta3 A T 17: 83,708,417 N16I probably damaging Het
Mtus2 T A 5: 148,077,314 S306T probably benign Het
Ncl G A 1: 86,352,517 P523S probably benign Het
Npepps G T 11: 97,238,221 A379E probably damaging Het
Ntng1 A T 3: 109,872,317 C315S probably damaging Het
Nyap2 C T 1: 81,241,327 P355S probably damaging Het
Olfr474 C A 7: 107,954,810 H56Q probably benign Het
Orc2 A G 1: 58,476,536 L271P probably damaging Het
Pck2 G A 14: 55,542,450 R52H probably benign Het
Pikfyve T C 1: 65,252,560 S1313P probably damaging Het
Pink1 A G 4: 138,325,967 F85L probably benign Het
Ppp2r3a T C 9: 101,185,976 T154A probably benign Het
Prb1 TAGGCCTCCCTGTGGGTGTGGGCCTTGTTGGTTTCCAGGCTGAGGAGGTCTCTGCTGGGGGCCTCCCTGTGGGGGTGGACCTTGTTGGTTTCCAGGCTGAGG TGGGCCTCCCTGTGGGGGTGGACCTTGTTGGTTTCCAGGCTGAGG 6: 132,207,904 probably benign Het
Prkg2 T C 5: 98,947,474 T613A probably damaging Het
Ptprz1 A G 6: 23,050,494 M2254V probably damaging Het
Rabgap1 T C 2: 37,487,140 V328A probably damaging Het
Rag1 T C 2: 101,644,507 S97G probably benign Het
Rai1 C T 11: 60,189,391 P1427L probably benign Het
Rrp15 G C 1: 186,739,725 A95G probably damaging Het
Rttn T C 18: 89,046,162 probably null Het
Ryr2 A C 13: 11,829,674 I392S probably damaging Het
Scoc T C 8: 83,435,914 K121R possibly damaging Het
Sept5 A T 16: 18,624,211 I206K possibly damaging Het
Sh2d2a C A 3: 87,849,348 L167I probably damaging Het
Slc5a2 C A 7: 128,268,767 Q202K probably damaging Het
Slco4a1 A T 2: 180,472,478 S518C probably damaging Het
Tbc1d2b A T 9: 90,205,130 L932Q possibly damaging Het
Tex15 T A 8: 33,574,291 Y1250N possibly damaging Het
Tln1 G T 4: 43,536,119 T2022K probably damaging Het
Trpc4 T A 3: 54,266,320 F378L probably benign Het
Ush2a A T 1: 188,784,669 Q3192L probably null Het
Usp40 A T 1: 87,957,313 W938R possibly damaging Het
Wdr24 T C 17: 25,824,498 V98A probably benign Het
Zfp280d A G 9: 72,362,507 *975W probably null Het
Zfp317 A T 9: 19,647,146 K219* probably null Het
Zfp986 A G 4: 145,899,228 K153E probably benign Het
Zmiz2 T A 11: 6,396,277 S71T possibly damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
R8033:Agbl3 UTSW 6 34839494 missense possibly damaging 0.95
R8203:Agbl3 UTSW 6 34799479 missense probably damaging 1.00
R8769:Agbl3 UTSW 6 34857614 missense probably damaging 0.96
R9072:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9073:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9255:Agbl3 UTSW 6 34812905 missense probably damaging 1.00
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34799408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGTGTCCTAAGCAGAATCCAG -3'
(R):5'- GAGTTATAAATACTGGCCTAGGAATGG -3'

Sequencing Primer
(F):5'- GCAGAATCCAGAACTTAGTCTCTG -3'
(R):5'- TAGCGAACGACCTACTTC -3'
Posted On 2022-02-07