Incidental Mutation 'R9210:Csgalnact1'
ID 698793
Institutional Source Beutler Lab
Gene Symbol Csgalnact1
Ensembl Gene ENSMUSG00000036356
Gene Name chondroitin sulfate N-acetylgalactosaminyltransferase 1
Synonyms CSGalNAcT-1, 4732435N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9210 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 68356781-68735146 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) T to C at 68461589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]
AlphaFold Q8BJQ9
Predicted Effect probably benign
Transcript: ENSMUST00000078350
SMART Domains Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 55 505 3.5e-85 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.2e-10 PFAM
Pfam:Glyco_transf_7C 409 478 1.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130214
SMART Domains Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 71 505 1.1e-59 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.6e-10 PFAM
Pfam:Glyco_transf_7C 405 478 3.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136060
SMART Domains Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 66 300 1.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,451,331 D40G probably damaging Het
Aass T C 6: 23,075,768 D790G probably damaging Het
Abcb4 C T 5: 8,955,591 P1158L probably damaging Het
Acod1 T C 14: 103,055,090 V350A possibly damaging Het
Acot2 C A 12: 83,988,077 P59Q probably damaging Het
Acyp1 A T 12: 85,280,046 V10E possibly damaging Het
Adhfe1 A T 1: 9,566,811 D396V possibly damaging Het
Agbl3 C T 6: 34,798,242 T161I probably damaging Het
Ang6 T C 14: 44,001,950 N107S probably benign Het
Arhgap28 A G 17: 67,855,435 M639T probably benign Het
Arpc5 A G 1: 152,766,852 D43G probably null Het
Asxl3 T C 18: 22,522,332 I1133T probably benign Het
Atp7b T C 8: 21,997,390 D1303G probably damaging Het
C2cd4b G A 9: 67,759,746 R8H probably damaging Het
Catsper1 T A 19: 5,341,507 V639E probably benign Het
Ccdc113 T C 8: 95,557,246 F316S probably damaging Het
Ccdc91 A G 6: 147,606,900 I375V unknown Het
Cfap65 G A 1: 74,920,408 T861I probably benign Het
Chd1 T G 17: 15,730,505 S153A possibly damaging Het
Cln6 A G 9: 62,850,691 H244R probably damaging Het
Cnn2 A T 10: 79,992,539 M117L probably benign Het
Col19a1 A T 1: 24,461,474 probably null Het
Dhx57 T G 17: 80,268,909 D584A probably damaging Het
Dnaaf2 G A 12: 69,197,828 A153V probably damaging Het
Egfem1 T G 3: 29,153,594 C144W probably damaging Het
Ercc6 T A 14: 32,569,865 I1062N probably benign Het
Ermap A T 4: 119,178,509 C427* probably null Het
Fam193a T C 5: 34,440,137 V94A probably benign Het
Fbxl14 T C 6: 119,480,674 M272T probably benign Het
Gm5678 A C 16: 93,630,239 S243R possibly damaging Het
Grm7 T A 6: 110,645,908 M14K probably benign Het
Herc6 A G 6: 57,662,365 Y906C probably damaging Het
Hps4 C A 5: 112,349,361 T70N possibly damaging Het
Hspg2 A G 4: 137,562,479 H3880R probably benign Het
Hus1b A C 13: 30,946,875 I267S possibly damaging Het
Igkv13-84 G T 6: 68,939,902 G61V probably damaging Het
Mrgprb2 A T 7: 48,552,644 V111D possibly damaging Het
Mta3 A T 17: 83,708,417 N16I probably damaging Het
Mtus2 T A 5: 148,077,314 S306T probably benign Het
Ncl G A 1: 86,352,517 P523S probably benign Het
Npepps G T 11: 97,238,221 A379E probably damaging Het
Ntng1 A T 3: 109,872,317 C315S probably damaging Het
Nyap2 C T 1: 81,241,327 P355S probably damaging Het
Olfr474 C A 7: 107,954,810 H56Q probably benign Het
Orc2 A G 1: 58,476,536 L271P probably damaging Het
Pck2 G A 14: 55,542,450 R52H probably benign Het
Pikfyve T C 1: 65,252,560 S1313P probably damaging Het
Pink1 A G 4: 138,325,967 F85L probably benign Het
Ppp2r3a T C 9: 101,185,976 T154A probably benign Het
Prkg2 T C 5: 98,947,474 T613A probably damaging Het
Ptprz1 A G 6: 23,050,494 M2254V probably damaging Het
Rabgap1 T C 2: 37,487,140 V328A probably damaging Het
Rag1 T C 2: 101,644,507 S97G probably benign Het
Rai1 C T 11: 60,189,391 P1427L probably benign Het
Rrp15 G C 1: 186,739,725 A95G probably damaging Het
Rttn T C 18: 89,046,162 probably null Het
Ryr2 A C 13: 11,829,674 I392S probably damaging Het
Scoc T C 8: 83,435,914 K121R possibly damaging Het
Sept5 A T 16: 18,624,211 I206K possibly damaging Het
Sh2d2a C A 3: 87,849,348 L167I probably damaging Het
Slc5a2 C A 7: 128,268,767 Q202K probably damaging Het
Slco4a1 A T 2: 180,472,478 S518C probably damaging Het
Tbc1d2b A T 9: 90,205,130 L932Q possibly damaging Het
Tex15 T A 8: 33,574,291 Y1250N possibly damaging Het
Tln1 G T 4: 43,536,119 T2022K probably damaging Het
Trpc4 T A 3: 54,266,320 F378L probably benign Het
Ush2a A T 1: 188,784,669 Q3192L probably null Het
Usp40 A T 1: 87,957,313 W938R possibly damaging Het
Wdr24 T C 17: 25,824,498 V98A probably benign Het
Zfp280d A G 9: 72,362,507 *975W probably null Het
Zfp317 A T 9: 19,647,146 K219* probably null Het
Zfp986 A G 4: 145,899,228 K153E probably benign Het
Zmiz2 T A 11: 6,396,277 S71T possibly damaging Het
Other mutations in Csgalnact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02025:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02037:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02059:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02074:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02079:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02080:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02094:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02127:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02128:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02157:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02158:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02197:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02201:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02206:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02207:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02214:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02215:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02229:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02243:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02247:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02248:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02250:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02389:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02394:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02397:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02398:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02400:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02404:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02405:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02406:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02420:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02425:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02428:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02436:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02437:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02438:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02468:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02470:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02472:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02473:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02474:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02475:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02510:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02529:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02530:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02531:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02533:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02543:Csgalnact1 APN 8 68461068 missense probably damaging 1.00
IGL02620:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02625:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02671:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02674:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02683:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02685:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02686:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02697:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02698:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02741:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02985:Csgalnact1 APN 8 68461043 missense probably benign 0.02
R0173:Csgalnact1 UTSW 8 68461029 missense probably damaging 1.00
R1594:Csgalnact1 UTSW 8 68358632 missense probably damaging 1.00
R1655:Csgalnact1 UTSW 8 68373689 missense possibly damaging 0.89
R1873:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R1955:Csgalnact1 UTSW 8 68372667 missense probably benign
R2421:Csgalnact1 UTSW 8 68461508 missense probably benign 0.42
R3195:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3196:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3951:Csgalnact1 UTSW 8 68461262 missense probably benign
R4304:Csgalnact1 UTSW 8 68372642 missense possibly damaging 0.94
R4989:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5133:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5134:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5503:Csgalnact1 UTSW 8 68461473 missense probably damaging 0.98
R5812:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R6143:Csgalnact1 UTSW 8 68373550 missense probably damaging 1.00
R6387:Csgalnact1 UTSW 8 68358713 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461109 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461110 missense probably damaging 1.00
R7023:Csgalnact1 UTSW 8 68358429 missense probably benign
R8318:Csgalnact1 UTSW 8 68461133 missense probably damaging 1.00
R8446:Csgalnact1 UTSW 8 68461091 missense probably damaging 0.99
R8519:Csgalnact1 UTSW 8 68401453 missense possibly damaging 0.65
R8674:Csgalnact1 UTSW 8 68373616 missense possibly damaging 0.91
R8782:Csgalnact1 UTSW 8 68358655 missense probably damaging 1.00
Z1088:Csgalnact1 UTSW 8 68401330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCATCTTTGCCTGTGGG -3'
(R):5'- AGGCTCCACTTGACTGACTG -3'

Sequencing Primer
(F):5'- TGTGGGTCCATTGGCCC -3'
(R):5'- TTCTGTCTAGAAAATCTTCCCTTGG -3'
Posted On 2022-02-07