Incidental Mutation 'R9211:Kmt2e'
ID 698851
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Name lysine (K)-specific methyltransferase 2E
Synonyms D230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9211 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 23434441-23504235 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23464772 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 86 (K86E)
Ref Sequence ENSEMBL: ENSMUSP00000092569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]
AlphaFold Q3UG20
Predicted Effect possibly damaging
Transcript: ENSMUST00000094962
AA Change: K86E

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: K86E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000115128
AA Change: K86E

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: K86E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000196889
AA Change: K86E

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: K86E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G T 1: 120,171,431 D85Y possibly damaging Het
Accs T C 2: 93,838,269 R315G probably damaging Het
Adam3 A C 8: 24,687,894 W668G probably benign Het
Adgrb2 T A 4: 129,992,406 V113E probably benign Het
Anapc4 C T 5: 52,850,652 T391I possibly damaging Het
Angpt2 C T 8: 18,698,062 G394D probably benign Het
Ankrd31 C G 13: 96,893,043 L1662V possibly damaging Het
Ankrd36 A G 11: 5,662,370 D1234G possibly damaging Het
Ankrd6 C T 4: 32,806,580 V558M probably damaging Het
Ankrd61 T A 5: 143,891,540 M206L probably benign Het
Arhgap33 C T 7: 30,523,598 G970R possibly damaging Het
Atf7 A G 15: 102,528,682 V115A unknown Het
Atp2c2 A T 8: 119,719,293 R65S probably benign Het
Atp8b5 T A 4: 43,367,960 M861K probably damaging Het
Bmi1 T C 2: 18,684,341 S279P probably benign Het
Bptf T G 11: 107,055,298 S2372R probably damaging Het
Cacnb2 A T 2: 14,874,497 I15L unknown Het
Card11 A G 5: 140,883,620 M807T probably benign Het
Ccdc175 A T 12: 72,106,684 D704E probably damaging Het
Cd300ld T A 11: 114,987,560 Y42F probably damaging Het
Cdh1 A T 8: 106,664,330 T693S probably benign Het
Clca4b T C 3: 144,932,453 Y16C possibly damaging Het
Col4a4 A G 1: 82,528,780 I273T unknown Het
Coro2b C A 9: 62,520,380 V9L probably benign Het
Crnkl1 T C 2: 145,932,853 D55G probably damaging Het
Dcps T A 9: 35,124,576 N338I probably damaging Het
Dusp2 A T 2: 127,337,391 H222L probably benign Het
Dync1li1 C A 9: 114,688,944 Y21* probably null Het
Efhb T G 17: 53,449,479 Q381H probably damaging Het
Elac2 A T 11: 64,979,038 probably benign Het
Etaa1 A G 11: 17,946,053 V688A possibly damaging Het
Fam109b A T 15: 82,341,026 probably benign Het
Fam120c C T X: 151,344,499 H84Y probably benign Het
Fbxl7 T A 15: 26,789,530 N37I probably damaging Het
Fndc3b A T 3: 27,468,937 W498R probably damaging Het
Galc G A 12: 98,207,440 A621V probably benign Het
Gch1 A T 14: 47,189,062 I69N probably damaging Het
Gdpd4 T C 7: 97,966,259 V97A possibly damaging Het
Hirip3 C T 7: 126,864,395 R485* probably null Het
Hmgcs2 C T 3: 98,297,432 T302I possibly damaging Het
Ing5 A T 1: 93,812,687 K137I possibly damaging Het
Kcnh8 T A 17: 52,839,208 Y375N probably damaging Het
Kdm3a C A 6: 71,596,690 W963L probably benign Het
Klra17 T G 6: 129,865,688 I216L possibly damaging Het
Krt42 T C 11: 100,265,041 N293S possibly damaging Het
Lrrc8d T A 5: 105,812,350 W209R probably damaging Het
Mettl23 C T 11: 116,843,643 P13S unknown Het
Ncln T C 10: 81,487,693 Y540C probably damaging Het
Neb C G 2: 52,245,348 G3250A probably damaging Het
Nebl A G 2: 17,388,690 probably null Het
Nqo2 A T 13: 33,972,416 T38S probably benign Het
Obscn A T 11: 59,135,867 I170N probably benign Het
Olfr1085 A T 2: 86,657,680 Y259* probably null Het
Olfr1186 A G 2: 88,525,826 D81G probably benign Het
Olfr1344 G T 7: 6,440,418 G173W probably damaging Het
Olfr313 A T 11: 58,817,883 N292Y probably damaging Het
Olfr478 C T 7: 108,031,591 V251I probably damaging Het
Olfr846 T A 9: 19,360,528 I276F possibly damaging Het
Pacs1 A T 19: 5,139,029 V775E probably damaging Het
Pmfbp1 T C 8: 109,535,813 I713T probably benign Het
Pnmal2 A G 7: 16,945,664 D191G unknown Het
Polr1a T C 6: 71,966,537 I1252T probably damaging Het
Prss16 A T 13: 22,008,584 M110K probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Rab5b C A 10: 128,683,194 probably null Het
Reln G T 5: 22,344,202 Y69* probably null Het
Rgs12 T A 5: 34,965,821 M316K probably damaging Het
Rmi2 T C 16: 10,839,879 C118R possibly damaging Het
Rnf223 T A 4: 156,132,377 C70S probably damaging Het
Rxrb T A 17: 34,036,652 F371Y probably damaging Het
Smurf2 T A 11: 106,868,637 S78C probably damaging Het
Sorbs1 A T 19: 40,344,354 probably null Het
Spag17 C T 3: 100,125,298 probably benign Het
Spidr T C 16: 16,053,455 H217R probably benign Het
Tiam2 T G 17: 3,448,454 V835G possibly damaging Het
Tm2d2 C T 8: 25,020,532 R136* probably null Het
Tnks C T 8: 34,849,335 D877N probably damaging Het
Tns1 A G 1: 73,917,789 L491P possibly damaging Het
Trps1 A G 15: 50,831,444 I485T probably damaging Het
Tubgcp5 A G 7: 55,806,583 S308G probably benign Het
Ugt8a T C 3: 125,867,481 H454R probably damaging Het
Usp32 G T 11: 85,022,733 T924K probably damaging Het
Vmn2r91 A T 17: 18,136,557 K829* probably null Het
Zfc3h1 T C 10: 115,412,423 F1146L possibly damaging Het
Zfp729a G T 13: 67,619,701 A803E probably benign Het
Zfp990 A G 4: 145,537,601 T390A probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 splice site probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
R8341:Kmt2e UTSW 5 23499453 missense probably damaging 0.98
R8383:Kmt2e UTSW 5 23485541 missense probably benign 0.08
R8400:Kmt2e UTSW 5 23497092 missense probably benign 0.17
R8546:Kmt2e UTSW 5 23481244 missense probably damaging 1.00
R8750:Kmt2e UTSW 5 23493217 missense probably benign
R8786:Kmt2e UTSW 5 23464866 missense probably damaging 1.00
R9660:Kmt2e UTSW 5 23478619 missense probably damaging 1.00
R9786:Kmt2e UTSW 5 23497984 missense probably benign 0.16
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGACTTTCATCTACTAGACAGTGAC -3'
(R):5'- GGTGTGAAATAGTTACCTGCATTTG -3'

Sequencing Primer
(F):5'- AGTGACATTAACTTATTACCACTGTG -3'
(R):5'- TGTCACAACAGATCATGTATCCGTC -3'
Posted On 2022-02-07