Incidental Mutation 'R9211:Atp2c2'
ID 698873
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9211 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120446032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 65 (R65S)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000095171
AA Change: R65S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: R65S

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212454
AA Change: R65S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G T 1: 120,099,161 (GRCm39) D85Y possibly damaging Het
Accs T C 2: 93,668,614 (GRCm39) R315G probably damaging Het
Adam3 A C 8: 25,177,910 (GRCm39) W668G probably benign Het
Adgrb2 T A 4: 129,886,199 (GRCm39) V113E probably benign Het
Anapc4 C T 5: 53,007,994 (GRCm39) T391I possibly damaging Het
Angpt2 C T 8: 18,748,078 (GRCm39) G394D probably benign Het
Ankrd31 C G 13: 97,029,551 (GRCm39) L1662V possibly damaging Het
Ankrd36 A G 11: 5,612,370 (GRCm39) D1234G possibly damaging Het
Ankrd6 C T 4: 32,806,580 (GRCm39) V558M probably damaging Het
Ankrd61 T A 5: 143,828,358 (GRCm39) M206L probably benign Het
Arhgap33 C T 7: 30,223,023 (GRCm39) G970R possibly damaging Het
Atf7 A G 15: 102,437,117 (GRCm39) V115A unknown Het
Atp8b5 T A 4: 43,367,960 (GRCm39) M861K probably damaging Het
Bmi1 T C 2: 18,689,152 (GRCm39) S279P probably benign Het
Bptf T G 11: 106,946,124 (GRCm39) S2372R probably damaging Het
Cacnb2 A T 2: 14,879,308 (GRCm39) I15L unknown Het
Card11 A G 5: 140,869,375 (GRCm39) M807T probably benign Het
Ccdc175 A T 12: 72,153,458 (GRCm39) D704E probably damaging Het
Cd300ld T A 11: 114,878,386 (GRCm39) Y42F probably damaging Het
Cdh1 A T 8: 107,390,962 (GRCm39) T693S probably benign Het
Clca4b T C 3: 144,638,214 (GRCm39) Y16C possibly damaging Het
Col4a4 A G 1: 82,506,501 (GRCm39) I273T unknown Het
Coro2b C A 9: 62,427,662 (GRCm39) V9L probably benign Het
Crnkl1 T C 2: 145,774,773 (GRCm39) D55G probably damaging Het
Dcps T A 9: 35,035,872 (GRCm39) N338I probably damaging Het
Dusp2 A T 2: 127,179,311 (GRCm39) H222L probably benign Het
Dync1li1 C A 9: 114,518,012 (GRCm39) Y21* probably null Het
Efhb T G 17: 53,756,507 (GRCm39) Q381H probably damaging Het
Elac2 A T 11: 64,869,864 (GRCm39) probably benign Het
Etaa1 A G 11: 17,896,053 (GRCm39) V688A possibly damaging Het
Fam120c C T X: 150,127,495 (GRCm39) H84Y probably benign Het
Fbxl7 T A 15: 26,789,616 (GRCm39) N37I probably damaging Het
Fndc3b A T 3: 27,523,086 (GRCm39) W498R probably damaging Het
Galc G A 12: 98,173,699 (GRCm39) A621V probably benign Het
Gch1 A T 14: 47,426,519 (GRCm39) I69N probably damaging Het
Gdpd4 T C 7: 97,615,466 (GRCm39) V97A possibly damaging Het
Hirip3 C T 7: 126,463,567 (GRCm39) R485* probably null Het
Hmgcs2 C T 3: 98,204,748 (GRCm39) T302I possibly damaging Het
Ing5 A T 1: 93,740,409 (GRCm39) K137I possibly damaging Het
Kcnh8 T A 17: 53,146,236 (GRCm39) Y375N probably damaging Het
Kdm3a C A 6: 71,573,674 (GRCm39) W963L probably benign Het
Klra17 T G 6: 129,842,651 (GRCm39) I216L possibly damaging Het
Kmt2e A G 5: 23,669,770 (GRCm39) K86E possibly damaging Het
Krt42 T C 11: 100,155,867 (GRCm39) N293S possibly damaging Het
Lrrc8d T A 5: 105,960,216 (GRCm39) W209R probably damaging Het
Mettl23 C T 11: 116,734,469 (GRCm39) P13S unknown Het
Ncln T C 10: 81,323,527 (GRCm39) Y540C probably damaging Het
Neb C G 2: 52,135,360 (GRCm39) G3250A probably damaging Het
Nebl A G 2: 17,393,501 (GRCm39) probably null Het
Nqo2 A T 13: 34,156,399 (GRCm39) T38S probably benign Het
Obscn A T 11: 59,026,693 (GRCm39) I170N probably benign Het
Or2bd2 G T 7: 6,443,417 (GRCm39) G173W probably damaging Het
Or4c100 A G 2: 88,356,170 (GRCm39) D81G probably benign Het
Or5af2 A T 11: 58,708,709 (GRCm39) N292Y probably damaging Het
Or5p6 C T 7: 107,630,798 (GRCm39) V251I probably damaging Het
Or7g28 T A 9: 19,271,824 (GRCm39) I276F possibly damaging Het
Or8k38 A T 2: 86,488,024 (GRCm39) Y259* probably null Het
Pacs1 A T 19: 5,189,057 (GRCm39) V775E probably damaging Het
Pheta2 A T 15: 82,225,227 (GRCm39) probably benign Het
Pmfbp1 T C 8: 110,262,445 (GRCm39) I713T probably benign Het
Pnma8b A G 7: 16,679,589 (GRCm39) D191G unknown Het
Polr1a T C 6: 71,943,521 (GRCm39) I1252T probably damaging Het
Prss16 A T 13: 22,192,754 (GRCm39) M110K probably benign Het
Pygo2 T C 3: 89,338,038 (GRCm39) probably null Het
Rab5b C A 10: 128,519,063 (GRCm39) probably null Het
Reln G T 5: 22,549,200 (GRCm39) Y69* probably null Het
Rgs12 T A 5: 35,123,165 (GRCm39) M316K probably damaging Het
Rmi2 T C 16: 10,657,743 (GRCm39) C118R possibly damaging Het
Rnf223 T A 4: 156,216,834 (GRCm39) C70S probably damaging Het
Rxrb T A 17: 34,255,626 (GRCm39) F371Y probably damaging Het
Smurf2 T A 11: 106,759,463 (GRCm39) S78C probably damaging Het
Sorbs1 A T 19: 40,332,798 (GRCm39) probably null Het
Spag17 C T 3: 100,032,614 (GRCm39) probably benign Het
Spidr T C 16: 15,871,319 (GRCm39) H217R probably benign Het
Tiam2 T G 17: 3,498,729 (GRCm39) V835G possibly damaging Het
Tm2d2 C T 8: 25,510,548 (GRCm39) R136* probably null Het
Tnks C T 8: 35,316,489 (GRCm39) D877N probably damaging Het
Tns1 A G 1: 73,956,948 (GRCm39) L491P possibly damaging Het
Trps1 A G 15: 50,694,840 (GRCm39) I485T probably damaging Het
Tubgcp5 A G 7: 55,456,331 (GRCm39) S308G probably benign Het
Ugt8a T C 3: 125,661,130 (GRCm39) H454R probably damaging Het
Usp32 G T 11: 84,913,559 (GRCm39) T924K probably damaging Het
Vmn2r91 A T 17: 18,356,819 (GRCm39) K829* probably null Het
Zfc3h1 T C 10: 115,248,328 (GRCm39) F1146L possibly damaging Het
Zfp729a G T 13: 67,767,820 (GRCm39) A803E probably benign Het
Zfp990 A G 4: 145,264,171 (GRCm39) T390A probably damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCCCTGCTTTACCAGAG -3'
(R):5'- GTTTCCTAACAGCGTTGGTC -3'

Sequencing Primer
(F):5'- GAGCCCTCCTAGCAAGATGTC -3'
(R):5'- CTCTGTGTCATTGCCAAAGGAGC -3'
Posted On 2022-02-07