Incidental Mutation 'R9211:Kcnh8'
ID 698908
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms ELK1, C130090D05Rik, Kv12.1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9211 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 52602709-52979194 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52839208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 375 (Y375N)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: Y375N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: Y375N

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.9592 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G T 1: 120,171,431 D85Y possibly damaging Het
Accs T C 2: 93,838,269 R315G probably damaging Het
Adam3 A C 8: 24,687,894 W668G probably benign Het
Adgrb2 T A 4: 129,992,406 V113E probably benign Het
Anapc4 C T 5: 52,850,652 T391I possibly damaging Het
Angpt2 C T 8: 18,698,062 G394D probably benign Het
Ankrd31 C G 13: 96,893,043 L1662V possibly damaging Het
Ankrd36 A G 11: 5,662,370 D1234G possibly damaging Het
Ankrd6 C T 4: 32,806,580 V558M probably damaging Het
Ankrd61 T A 5: 143,891,540 M206L probably benign Het
Arhgap33 C T 7: 30,523,598 G970R possibly damaging Het
Atf7 A G 15: 102,528,682 V115A unknown Het
Atp2c2 A T 8: 119,719,293 R65S probably benign Het
Atp8b5 T A 4: 43,367,960 M861K probably damaging Het
Bmi1 T C 2: 18,684,341 S279P probably benign Het
Bptf T G 11: 107,055,298 S2372R probably damaging Het
Cacnb2 A T 2: 14,874,497 I15L unknown Het
Card11 A G 5: 140,883,620 M807T probably benign Het
Ccdc175 A T 12: 72,106,684 D704E probably damaging Het
Cd300ld T A 11: 114,987,560 Y42F probably damaging Het
Cdh1 A T 8: 106,664,330 T693S probably benign Het
Clca4b T C 3: 144,932,453 Y16C possibly damaging Het
Col4a4 A G 1: 82,528,780 I273T unknown Het
Coro2b C A 9: 62,520,380 V9L probably benign Het
Crnkl1 T C 2: 145,932,853 D55G probably damaging Het
Dcps T A 9: 35,124,576 N338I probably damaging Het
Dusp2 A T 2: 127,337,391 H222L probably benign Het
Dync1li1 C A 9: 114,688,944 Y21* probably null Het
Efhb T G 17: 53,449,479 Q381H probably damaging Het
Elac2 A T 11: 64,979,038 probably benign Het
Etaa1 A G 11: 17,946,053 V688A possibly damaging Het
Fam109b A T 15: 82,341,026 probably benign Het
Fam120c C T X: 151,344,499 H84Y probably benign Het
Fbxl7 T A 15: 26,789,530 N37I probably damaging Het
Fndc3b A T 3: 27,468,937 W498R probably damaging Het
Galc G A 12: 98,207,440 A621V probably benign Het
Gch1 A T 14: 47,189,062 I69N probably damaging Het
Gdpd4 T C 7: 97,966,259 V97A possibly damaging Het
Hirip3 C T 7: 126,864,395 R485* probably null Het
Hmgcs2 C T 3: 98,297,432 T302I possibly damaging Het
Ing5 A T 1: 93,812,687 K137I possibly damaging Het
Kdm3a C A 6: 71,596,690 W963L probably benign Het
Klra17 T G 6: 129,865,688 I216L possibly damaging Het
Kmt2e A G 5: 23,464,772 K86E possibly damaging Het
Krt42 T C 11: 100,265,041 N293S possibly damaging Het
Lrrc8d T A 5: 105,812,350 W209R probably damaging Het
Mettl23 C T 11: 116,843,643 P13S unknown Het
Ncln T C 10: 81,487,693 Y540C probably damaging Het
Neb C G 2: 52,245,348 G3250A probably damaging Het
Nebl A G 2: 17,388,690 probably null Het
Nqo2 A T 13: 33,972,416 T38S probably benign Het
Obscn A T 11: 59,135,867 I170N probably benign Het
Olfr1085 A T 2: 86,657,680 Y259* probably null Het
Olfr1186 A G 2: 88,525,826 D81G probably benign Het
Olfr1344 G T 7: 6,440,418 G173W probably damaging Het
Olfr313 A T 11: 58,817,883 N292Y probably damaging Het
Olfr478 C T 7: 108,031,591 V251I probably damaging Het
Olfr846 T A 9: 19,360,528 I276F possibly damaging Het
Pacs1 A T 19: 5,139,029 V775E probably damaging Het
Pmfbp1 T C 8: 109,535,813 I713T probably benign Het
Pnmal2 A G 7: 16,945,664 D191G unknown Het
Polr1a T C 6: 71,966,537 I1252T probably damaging Het
Prss16 A T 13: 22,008,584 M110K probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Rab5b C A 10: 128,683,194 probably null Het
Reln G T 5: 22,344,202 Y69* probably null Het
Rgs12 T A 5: 34,965,821 M316K probably damaging Het
Rmi2 T C 16: 10,839,879 C118R possibly damaging Het
Rnf223 T A 4: 156,132,377 C70S probably damaging Het
Rxrb T A 17: 34,036,652 F371Y probably damaging Het
Smurf2 T A 11: 106,868,637 S78C probably damaging Het
Sorbs1 A T 19: 40,344,354 probably null Het
Spag17 C T 3: 100,125,298 probably benign Het
Spidr T C 16: 16,053,455 H217R probably benign Het
Tiam2 T G 17: 3,448,454 V835G possibly damaging Het
Tm2d2 C T 8: 25,020,532 R136* probably null Het
Tnks C T 8: 34,849,335 D877N probably damaging Het
Tns1 A G 1: 73,917,789 L491P possibly damaging Het
Trps1 A G 15: 50,831,444 I485T probably damaging Het
Tubgcp5 A G 7: 55,806,583 S308G probably benign Het
Ugt8a T C 3: 125,867,481 H454R probably damaging Het
Usp32 G T 11: 85,022,733 T924K probably damaging Het
Vmn2r91 A T 17: 18,136,557 K829* probably null Het
Zfc3h1 T C 10: 115,412,423 F1146L possibly damaging Het
Zfp729a G T 13: 67,619,701 A803E probably benign Het
Zfp990 A G 4: 145,537,601 T390A probably damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
R7952:Kcnh8 UTSW 17 52959465 missense probably benign 0.02
R8176:Kcnh8 UTSW 17 52978094 missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 52956908 missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 52905073 missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 52978292 missense probably benign
R8716:Kcnh8 UTSW 17 52977752 missense probably benign 0.02
R8943:Kcnh8 UTSW 17 52797458 missense probably benign 0.00
R9051:Kcnh8 UTSW 17 52834614 missense probably damaging 1.00
R9233:Kcnh8 UTSW 17 52978140 missense probably damaging 1.00
R9243:Kcnh8 UTSW 17 52898514 missense probably damaging 1.00
R9327:Kcnh8 UTSW 17 52839056 missense probably damaging 0.99
R9640:Kcnh8 UTSW 17 52878061 missense probably damaging 1.00
R9646:Kcnh8 UTSW 17 52797545 missense probably benign 0.25
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTGTGGATGTGGCTTCCAAG -3'
(R):5'- GTACACAGATGAGAATTGCCTATG -3'

Sequencing Primer
(F):5'- TCCAAGCTGTGTTGCTCTG -3'
(R):5'- CACAGATGAGAATTGCCTATGTAATG -3'
Posted On 2022-02-07